EY692337

Overview
NameEY692337
Unique NameEY692337
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length341
Libraries
Library NameType
Sweet orange bark, greenhouse plantcdna_library
Properties
Property NameValue
Genbank descriptionCS00-C2-003-059-C11-CT.F Sweet orange bark, greenhouse plant Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY692337 ID=EY692337; Name=EY692337; organism=Citrus sinensis; type=EST; length=341bp
CCTATCGGGAAATTCTTTGGCCCCTTTACAGAGCTCAAAATAAAGCTTGA
TCGATGTTTCCGTCCTTAAAAAGCTGTGAAGCGGAAGGCAAACTTCGAGC
AGAGCAAGAAATTGAAAGAAAGGCTCGAGTCATTGAGGAAAGAAACTGCT
GAGGCTGAAGCAAAATTTTGAATTTGATTTTGAACTCTCAATTAGATGAG
ATTTCAACGCAGCATAATATGATTGGTATAGTGAACCTGTAAAAACTAAA
AGGTCTTATGCTGCGGTCACGCAATTCTTAAAATTCTGTTACTCTTTTTC
TCCCTATAAGAAATATATTTCGAATCAAAAAAAAAAAAAAA
back to top