EY692333

Overview
NameEY692333
Unique NameEY692333
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length1038
Libraries
Library NameType
Sweet orange bark, greenhouse plantcdna_library
Properties
Property NameValue
Genbank descriptionCS00-C2-003-059-C02-CT.F Sweet orange bark, greenhouse plant Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY692333 ID=EY692333; Name=EY692333; organism=Citrus sinensis; type=EST; length=1038bp
CCACGCGTCCGGAGGGTGTTGTCATGAATATGACACTTCTTACTGAATGT
CGCTCTTTGGTTATCTCTTTATATGTTACATGTTGTTGTATTCCACTAAT
TTACCATTAGTGATTAAATTCATCAAGTGCTTTGATCTTCATGAGTGTGT
GGGGGTGTTTGTTTTATTTTGTCTTTCTTGATTTTCCTGATTTTATCTTT
TGCTAAATACAGAGTGATGTATTGAAGGCAACAGTGGCAGCAGATGCTAT
CACTGGGAGTATGGTAAGACTTCTCTTTTTTATCCTCATTTGAAGTTAGA
TTTCATTTTGATTTAGTAGAATGATACAATTTAATTTTATGAAATTGTTT
CACACACTGATGTTTTTTATTATCTATCTACTCCCGTTTCTCTAAGTATT
AACAACATTTAAGTGTGAAGATGATCATCATTTCTACATGCTTACTTAAT
AAAGATAAAATCTATTATTGCATTACTGAAACAATACAAAACGTTAGTAG
GTATAATAATGATTGAATAAAAAATTTAGATATCAATTCATTAATCAACT
ACATAACTCTTGGGATTGCGTGATTTATTTACTTTAATTTATTTTACATC
ATTGATTAATTAGAATTAATTAAAAATAGATCTAAGTTTCGAAACTCATG
GTATCGAAATATGGAGAGGAAAACTAAATTAATGTTCCATATAATAAATA
TAGAAATAAAAAAACAAATATTCATATACATTCATAATCATAAAATAATC
TTAAAACAATAATAATACATTAAAAAAATATCTTAACAGAAATACATATC
AAAAACACATATGCAATACATTACACGAACAATATACTCAATACTGTAAA
ATCCCATCTAATACTACCTAATATTTCATATCAAAAATACAACCTACTTA
ATATCAATAGCTTAAAAAAATATAATCACAAATAAAAATAATAAAATATA
AAATAGACAAAAACAGACAATAAAAAAAAGAAAATTAAGTATTACAAAGA
TAATATGACAACAATGAGAAATGAATAGAAGCGATGAT
back to top