EY692332

Overview
NameEY692332
Unique NameEY692332
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length545
Libraries
Library NameType
Sweet orange bark, greenhouse plantcdna_library
Properties
Property NameValue
Genbank descriptionCS00-C2-003-059-C01-CT.F Sweet orange bark, greenhouse plant Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY692332 ID=EY692332; Name=EY692332; organism=Citrus sinensis; type=EST; length=545bp
GAATAAAATGTTCGGGTAAGACAAAAAGGGCGAACTGGGGATGGCATTAA
CAGGGAGCCGTGGAACCGTTATTACATGCTACCGAAGGGGAAAGGAGGTT
TCCAGATTGCCCCATGGCTTTCGTTTCCGGCGCAAGGGGGAAGGGGAGGA
AACTTCCGACGTGGGCGAGTTTATTGCGTGCTGGATGGTACGACAGATAA
GGTGATGGAGGGAACGGGAAGTATGGCGAATGGCTGGGGCAGGTGAAGGG
GGTTGAGGGAGGGATAGGACCGCCACCGAGTGCCGGACTCAAGGATGCGC
GAAGCCGACGCTTAGGCCTGAGCGGAAGAGTCCGGCAGCATGTCGCTCGA
CCCAGACTTGCAAAATGGTGCAGGTTGATGCGATATCCAAGGTCATGGAG
GTTAAAGGCCACAAGGCGGCGGGGCGCGCTGAACACTGTCTCAAGCCGAG
TGGGGTAGGAACAGGGAGGTCGGGGGTCTGACTCTTGCGGAGTATCTATG
TGATTGCTATTTATGCGGTGATCCTAACTATAATAATAATGATAA
back to top