EY692325

Overview
NameEY692325
Unique NameEY692325
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length1017
Libraries
Library NameType
Sweet orange bark, greenhouse plantcdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionCS00-C2-003-059-B02-CT.F Sweet orange bark, greenhouse plant Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY692325 ID=EY692325; Name=EY692325; organism=Citrus sinensis; type=EST; length=1017bp
AACGATTTTACAAGCTCTATTACTGCACAGGATCCTTCCAATAATCAACC
TGTGAATCATGTGACATCATCTGCTGAGCAAACATCAGAAATAGAGTCAT
CGGCAACCAAGAACTTGCAGAATGTTGATTTTGGTAGCTTTTTGGAACCA
GACATCTTTTTAGGAGCATCACACAATCAAAATGGTTCTTTCGAAGTAAA
CATTATGAAGTCAGAACCTTCAGTCTCAAATAGGATTTCTGATGTGAAAG
CACAAGATGGAGTAAATGCTGGAGATTCTGCAAAAGGAGATATTTTAAGT
GCAACTAAAAGATCAACTGAAGATTTAGAGACTTTAATGTCTCAGATGCA
TGATCTCTCATTCATGCTTGCTAGCGATCTCTCAATTCCTCCAAAACAAA
GATGAATTCACTCCAATTTCTCAGGATTGCTGGCCAAATTATTATTTTTG
GATTCTCAGTATATAATACTTGTTGTTCAATATGTATTCTAATATTGATC
GATTTGTATTCCGGGATTCTTTTACGAAGTTGGGCTGTGGCCCGACCCTC
AAGTTTTTTTTTTTTTTCCCTTGATTTCCGCCCCCAAGCAGCTCCTTTTT
CCCGGTGGGCAGTTATATTTGGTAGTGGGATGAGGTGGATCGGAAGGGAA
ACCGAGGAAACACGTTGAAAATAAAATGGTTTCTCCGGGAGATCAAAAAA
TAAAAAGAAAAGACGAAAAAATGAAAAAGGGGGGGGCGGCTTGTAAGGGA
AACAAGTTAAATTATCTGGGGCCAAGAGAAGGGGAAGAGATTGTGTTATA
GGGGTTCTGCAAAAATATCTTTTCAATGAGAGGCAGGTATATAAAACACT
TTGAGGAGGTGGGAAAAACAAAGGGGTGGAAAGCCACAGGATAAAAGGTC
ACTTGGAGAGCGAGATACACCCCCTACTTTACCGCAGATTGGGGGTATAT
AGACAAGAACAAAAGAGGGGGCGGAGAGCATGAGGGATTGAGATCGCGTT
GTGCCAACGGATGAAAG
back to top