EY692323

Overview
NameEY692323
Unique NameEY692323
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length966
Libraries
Library NameType
Sweet orange bark, greenhouse plantcdna_library
Properties
Property NameValue
Genbank descriptionCS00-C2-003-059-A11-CT.F Sweet orange bark, greenhouse plant Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY692323 ID=EY692323; Name=EY692323; organism=Citrus sinensis; type=EST; length=966bp
GGCCGGGTAACCGGGTCCGGGATTTCCCGGGTCGACCCACGCCGTCCGAT
NAGNCTACTAAAAGAAAATACCCCCTTTTAAGAAAAATTAAAAAAAAAAA
TTTAAAAAAAAAAAAAAAAAAAAAAAAACAGAAAATACAAAGAAAAAGAT
AAAGAAAAAAGATAAAAATGGGGGGGCCCCCTGAAAAAAACCAAGCTCTC
TTGGGGGGGAAGGCCAGCCCTGACCTTTTATACAGGTTCCCCACAATTTT
ATATCCCGGGCCCGCTTTTTATATTGCACCGTAGGGAAAAACCTGGGGAT
GACCCTCTTTTCCCCCTTTCACATATTTCCCCTTTTCACGGGATGGCAAT
CTACAAAAAAAACCCCCACTTTCCCCCCTTCCAAATATTTTCTCACCTGA
AAGGGGAAATGGGCACCCCCTGTTTGCAGGGCTTCAATGCGCTTGGTGGG
GTGGTTCACCGCCAATGGAACCTAATTACTTGCTAAACCCCTTCATGCCC
GCCCCTTTTATTTTTTTCCTTTTTTTTCTCCCAAGGTACCCCGGTTTTCT
CCCGTATGGCTTAAAACAAGGGCCCCCATTTAAGGATCCAATATTCTCTT
TTTAGGCCCCCCAACCCCAAAAAATTGTTATAGGGGGTAGGTCCCATAGG
GGGGGCCCCCCCCTGAAAAAGTGTTTTCCCCCTTAGAAATTGGACCCCTC
TCTTATTAGGTGTACTTTGTTTCCCCTTTAGAAACAACCTCTTCCATATC
TCTATTTTTTTTTTTTATTTTAAAGGGATTTTAGCAATTTTCCCCTTTAG
TTATAAAAGAGCATAATTTAAAAAATTCATCATAAATTTATACAAAAAAT
ACCCCTTAATTATAAGACATTTCTAGAGAAAAGCACGACACACCCTATTT
GTTTATTTTTATATACCTCTTTAAATATTCCATCCAAGATATATCACCCT
TAGTTAGTGTTGCTCG
back to top