EY692322

Overview
NameEY692322
Unique NameEY692322
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length986
Libraries
Library NameType
Sweet orange bark, greenhouse plantcdna_library
Properties
Property NameValue
Genbank descriptionCS00-C2-003-059-A10-CT.F Sweet orange bark, greenhouse plant Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY692322 ID=EY692322; Name=EY692322; organism=Citrus sinensis; type=EST; length=986bp
GTCCGAAAATTATTATAAATTATATTTTCCCCTTTTTAAAAAAAAAAATA
ATAATATAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGTAA
AAAAAAAAAAAATTAAAAAAAAAAAAGGGGGGGCCGCCCTGAAGAATCCA
AGTTAACTAACCCTTGGTGGCAAGTCCAAAGTTTTTTTTTTGTGTTCCCA
AAATTCATTTCCGGGGCCCCCTTTTTTCACGTTTGTGGGGGGAAAACCCC
TGCGTTTCCCCATTTTTACCCCCTTGTGGCCCCTCCCCTTTCCCCCGTTG
GGCCAAAAACCAAAAAGGCCCCACCCGTTCGCCTTTCCCAATTTTTTCTC
AGTCTTATTGGTTAAGGGAACCCCCCCTTTACCGACCTCTTTACCCGGCG
GGTGGGGGGGGTTACCCACAATGGGAAGTATAAATTTTGTAACTACCTAA
ACCCAGCCATTTTGATTTTTTTCTTTTATTTTTTACAAAAGATTTTCGAG
GTTTTCCCGATAATCTTTTTAAACGGGGGCTCCTTTTAGGGTTCCCATTA
TCGTGTCTTATTGCCACCCACCCCCAAAAAACTTTATAGTAGAAATGGTC
TCCTTATGGGGCACACCCCCGAAACACAATGTTTTTCTCCCCTTTGCAAT
TGAGATCTCAGTCTTTTATATATGGGACTTATTTATCNCATATGGAAACC
AAATTGCTTCTTTTTTCTATAATTTTTTTTTTATTTTTTTAAGTTTTATA
TCTTATTATTTAACCATAATTTTTATATACAATTCCCCGTACTTATTAAA
TTTTTTCTCCCTAATTTTATTCTATATATTTAATCTTTAGTATATAAGTA
TGGAATTTTTGTAGCTGAATTATGCTTGAAATATCCAATTTTTAAATTTT
TTTTAAATTTACTTAACAAATAGCTATTCACTCACAAGAGTAGCTAACAT
TAGTTATATTGTTACATTTATTTTATTTTTTAAACT
back to top