EY692060

Overview
NameEY692060
Unique NameEY692060
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length353
Libraries
Library NameType
Sweet orange bark, greenhouse plantcdna_library
Properties
Property NameValue
Genbank descriptionCS00-C2-003-106-C04-CT.F Sweet orange bark, greenhouse plant Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY692060 ID=EY692060; Name=EY692060; organism=Citrus sinensis; type=EST; length=353bp
AGAGGATCAAGAAGACTAAGGATGAAAAGAAGGCAAAGAAAGCGGAGACG
ATGTCCAAGTCACAGAAGTCTCAAGTCAAAAGTAGCGTGCCTAAGGGTGC
CGCCCCGAAGGGCCCCAAGCTAGGCGGTGGTGGTGGAAAGCGGTGAATTG
CTTAGTCTTTTCAAATCTGCAGATGAGTATAAACAATTAGAACTTAATTT
CATGTTTCTTGTATGGATTGATCAATCATGTAGACCAGATTTTTTTGTGG
TTTTTGTTTATGGTTTTGCATTGGGAGTTAAATTTGCCTTTTACTTAATT
GAATCAAAGTTTTCTCAAGCGAAAAAAAAAAAAAAAAAAAAAAATAAAAA
AAA
back to top