EY692051

Overview
NameEY692051
Unique NameEY692051
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length1115
Libraries
Library NameType
Sweet orange bark, greenhouse plantcdna_library
Properties
Property NameValue
Genbank descriptionCS00-C2-003-106-B02-CT.F Sweet orange bark, greenhouse plant Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY692051 ID=EY692051; Name=EY692051; organism=Citrus sinensis; type=EST; length=1115bp
CCGGGGAATTTCCCCGGGGTACGACCACGCGTCCGCCATGGGCTATTGCT
GCCACTCCTTGTTGATGATAACATTGCGAATGATGTCAATCTCGATCTTC
TTACTGTCCCTCAATATGGGAGAAATATTGATCAAACCGGTTAAATACAA
GCAATATTACTCTTTTGTGTTATGCTTATTTAAATAAAAAGATGGGTATT
GTTATTACCTATCAATGTGTGAGTGTTTGCTTATTCAGTTCTACTGAATA
AGATATCTTAATATGTATAAGAGTTTTTTTTTATTTACTATCTTTGTGTG
GCGTCTTTCTGGAAAAGATAATTACTGAATAAAATTGTTGCGTCTGTTAT
AAAATAAAAAAATAATAAAAAATAAAAACTAAAAATCATTTTCATAAGCA
AAAATAATTATAAACATAAAACTACTAACTAATAATAATAATACTAGAAC
AGATGTCTGTGTCTTATACCGCGTACCTACGTAATTTTATATACGAGGGG
GGTGGCACCATTAAAAGATTCAACATATATTGTGACGTCGGGAATAAGCT
AGACTTATCCATTAATAAGAGAAGCAAAATAACAAAAAATATGAACCATA
ATTTAAGCACACCCCTGAAGGAGAAAGTCCCTCGTCAATCATACATATTA
TATCCCTGCGGCCCCCGCTTTTCCTTTATTTACAATATTGGGTGTATAAA
AAGAAAAATAGCAAGAATACAATAACCCCTATACCTCAAAGTATAAGTAA
CAACCAACAAATGAGAAGAAAAGAAGGAAACCCCAATGAAACGAGCTCAT
TAATTAATGGCGGAGTGGCAGGAGGTTTTAAAACAGTACGTAAATCTACT
ATATCTTTTCTTAATGTGCATCATCGACAACTAACGTCTTTTTTGAATTA
CATTTGTATGTCCATCTATAATTTATCTAGATGAGCACAGATATGATTTT
GATTCGTTCTTGATAAACTATATAAGAGAAGGGGACATTCCCTATAATGG
GGAAAAGACAAGAAATATAGATGGAAGACTATAAATTAAACTCACCCACA
CCTCTAACAAAAAGAAAAATGAAATATGAAAGTAAATTGGAAGCAATTTG
ATTATTAGGATTCAA
back to top