EY692049

Overview
NameEY692049
Unique NameEY692049
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length451
Libraries
Library NameType
Sweet orange bark, greenhouse plantcdna_library
Properties
Property NameValue
Genbank descriptionCS00-C2-003-106-A10-CT.F Sweet orange bark, greenhouse plant Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY692049 ID=EY692049; Name=EY692049; organism=Citrus sinensis; type=EST; length=451bp
AAAATATTGTAAAAAAAAGAAGAGTACGGTCCAGGATTCCGGGGTCGACC
CCCGCGTCCGAATATAGTGCACTCGAAGCTACCTTTGATCTTTTCTGACT
TGAAGAATATGAAGACTCTTCCTGGCGCAGGTATGAGCGATCCGTCAGAA
GGTTACTTACTCCCCCCTTCCAGTATTGCTGATGATGATGTTGGGAATGA
CAATCTTGATCTTATTGTTATTCCTCAATATGGGAGAAATCCTGATTATT
ATGGGTAAGTGTCTACAATCTGGATGATGATATATTTAATTAAATAAAAA
GATGGGTACAGTTATTACCATATCAATTATAGGAGTGTCTATTTAGTTCA
GTTCACTTACATAAATCTCTTATACTAGAGATTATCTATGTAAGCGTTCA
TGTACTTTGTCTTCTTTATTTAATGGTAATACTTTTCGTGACAACGCAAT
A
back to top