EY692047

Overview
NameEY692047
Unique NameEY692047
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length987
Libraries
Library NameType
Sweet orange bark, greenhouse plantcdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionCS00-C2-003-106-A08-CT.F Sweet orange bark, greenhouse plant Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY692047 ID=EY692047; Name=EY692047; organism=Citrus sinensis; type=EST; length=987bp
TTTGCCACTCATCATGGCCACCTTTATTATTGCATGCTCCTTATCCATTC
CTATCAGGGCATCCTCTGGATCTGGGTACCAAGAACCCGAATCCAATCGT
ATAAAGCCTCCTTCCTCCTCCTCCTCCACCTCCTCCTCCTCTTCGACCAA
TTGGTGGGCCCCTCTCTTCGGCTGGTCATCCGATCCCGGCTACCTTAACA
ACAACAACAGGAAGAAAAACCAACTGGAGATGGCGGGTACAGATAATAAT
TCGGGTCGACCCGGATCGAGGTTCTCGCCCGGCTGTTTCACGGAGGAGAA
GGCGAAGCAGCTGAGGAAGAAGACTGCGGAGAGCTCGTCATTCCACGATG
TAATGTACCACTCGGCGCTCGCCTCCCGGCTCGCGTCCGATATGTCGGTT
TTGCCGGAGAAGTGACCGGATCGGATCCAGTTATCCGTTCTCCGGAAAAC
GAAACAGGTTTTAAGGTCTGGCATTTTTCGTTTATATTTGGAATTTGCCT
TGGCTTGGTTAATTTTGTCGAAATGAAAGAAAAATAAGGATGGCACTTAT
TAATGAGTGGTTGGGAACAACGAATGTTCGTGTAACGTACAGAAGAACAT
CCGTCTGATCATTTCTTTGATTAGGGGGGAAGAAAAAAAGGATCAAATTT
TTTCTTTGGAGATTCCAAAAGGTAAAAAAGGGGTCCGAGTAGGCCTAATT
AGACAATGGTGTAAGGTGGAGGAAATTCTTTAGCTTTTTTATTAAAAATA
TTGTATAACTTTTTTTTAGGGAAGAAAAAAAAGAAAATAGAGGGTGGACC
TTTTAGTAGGGATACAGAGATTACGAAATACCTGGTGGAGGCTAGGATTA
TTAATCTCCTATCCAGATGAAGGATCACTAAAAATTACAGTATAAATGGA
GGCACAGGGTTATAATTCAAGAATAAGAAGCTAAGGAAAAAAAACAACTA
GGAGCTTGTACCGCACATAAATATAAAGACATACAAG
back to top