EY692044

Overview
NameEY692044
Unique NameEY692044
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length913
Libraries
Library NameType
Sweet orange bark, greenhouse plantcdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionCS00-C2-003-106-A05-CT.F Sweet orange bark, greenhouse plant Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY692044 ID=EY692044; Name=EY692044; organism=Citrus sinensis; type=EST; length=913bp
AGTTATAAAAGGAATGGATGTTGTCTAGGCTATTGAGAAAGTGAAGACGG
ACAAGAATGACAAGCCATATCAAGACGTAAAGATTTTAAATGTGACCGTC
CCCAAGTCTTAGACACTCCCAGAGGCGTACAAATGGTTGATTGGAATTCC
TCATTAATAAGTATTGATGACAAAATCATTTTTCAGGCAAGTCTTTTTGT
TTGTTTTCACTAGACAATCAACGTTATCCTCCTAGAAACTAATTGGGGTG
AAAGAGAAATGGAACAGATTCTCTCGAACAGCTAGAAGAAAGAAAGAGAA
AACAGCAGCATTTGCAGTGTAAAGTGTAGACATCGTTCAGGAGTGATAAC
AGTTCAAAAGTGAGTTCTCAAGACATTTCTAAAACTCTGCTCTTGTTAGG
TATATGTACCATAGCCACTGCAATTTAACTTTCTGCCTTCTGTAGTTGGT
GACACCTTATGTCACATTCTATTGCTGGAGCAATATGTTGTTTTCGTTAA
AATAGATTTTTTGAGTCNNANNNNNNNANNNNAANNNNNAAAATAAATAA
AATAATTANTAAAAAATAAATTTATATAATTTATTTAATTANTAATAAGG
GAAGGTAATAAAAAAAATACATTGTTTATTTAGAGTGGATGATTATAATT
ACGTCTTATTATGAAGACTAGATATTTTAAAAATCGGATGGTATATTTTA
AGAATGGCATGTGGGGAAAATTCAGGGTAATTCTTCTTTCAATTCGACGG
TTAACACCAGCACTCCATTTTCTACTTTGTGAGATAATACATAGAATCTC
CCTATCTTCTTCTCTCTTTCCCTACTTTTTTAATATTAATAAAAAATTAA
TATAATATAGTTACCTGTAACAATTACTAATTAATAACGCGGATGTGGAG
GTAGGTATGTTAT
back to top