EY692043

Overview
NameEY692043
Unique NameEY692043
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length498
Libraries
Library NameType
Sweet orange bark, greenhouse plantcdna_library
Properties
Property NameValue
Genbank descriptionCS00-C2-003-106-A04-CT.F Sweet orange bark, greenhouse plant Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY692043 ID=EY692043; Name=EY692043; organism=Citrus sinensis; type=EST; length=498bp
GGTCCGGGGTCCGGAAATTCCGGGTCGACCCCGCGTCCGTTTTTTTGGGT
CTCTGGTAATCCCTTTAAATCTGTCCAGAGGTGGAGGATAAATCATTGGC
AGTAATAACCTTACGCCCTTGTTACTATTGCCGCAGCACGAATAGTCTCA
CTGCATCAGCATTTGTTGTGTATGCCGAGGTGCTCGACAGATTTTATGTC
AACAACTGATCCGAGGGCTCTGATCGAAACTGTAGATTAGAAAGTTTGTC
GCACAAAGTTGCTGCAATTCATTTTTTTTTTTTTTTTTTTGGTTCTTTTT
GTCAAGGCGATTGTAGCAATTCATTCATCCAATTTTTTGTTCCCCCCCAC
CCCCCGGGGTTCTTTATTTCTTTGTTATCTTGATATTGGACCCAAAAGTT
TCTGTATTGAACAATCACTGATGACCACGGAATGACATAGCAACCATTGT
ATTGTGAAAAACAAAACAACAACGAAAGAACCAAATAAAAAAAAAAAG
back to top