EY685119

Overview
NameEY685119
Unique NameEY685119
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length438
Libraries
Library NameType
Sweet orange bark, greenhouse plantcdna_library
Properties
Property NameValue
Genbank descriptionCS00-C2-003-010-A06-CT.F Sweet orange bark, greenhouse plant Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY685119 ID=EY685119; Name=EY685119; organism=Citrus sinensis; type=EST; length=438bp
AGCAACTTAACTACTTTTGCCCTTTCTTCCCCGTAAGCAGAGATCTTTCT
GCGAACATGGAAACTACCTGTGCAGGTAATAAGTGGTCGGAGACTGTGAA
CGTCCAGCCGTGGCACAGTATTGCTGATGATGATATGGTGAATGACAACC
TTGATCTTCTTGTTGTCCCTCAATATGGGAGAAACCCCGACCGTATGGGT
TAAGTGTAGTGCTATTTTTTAATGTTATGTTTAATTAAATAAATGATAGG
TATATTGTTACCTATCAATCATGTTAGTATCTTAGTTTGGTTCAATTCAG
CTTACAAGATCTCTTGATATGTAAAAGAGGTTTTCTTTATTTACAAAATG
ATTTCCTTACACGGAAAATAACCTAACTACCAGTTACTATGTGCGTCGGG
GGGGGAGACACTAACAAAAAAACACAAAAAAAAGATAA
back to top