EY685111

Overview
NameEY685111
Unique NameEY685111
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length959
Libraries
Library NameType
Sweet orange bark, greenhouse plantcdna_library
Properties
Property NameValue
Genbank descriptionCS00-C2-003-008-H08-CT.F Sweet orange bark, greenhouse plant Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY685111 ID=EY685111; Name=EY685111; organism=Citrus sinensis; type=EST; length=959bp
CCACGCGTCCGCTCAACTACTTGCTTTTCATTGCATTAATAGGAAGAGTT
CTTTAATTTTCTGATTTGAAGAATATGGAAGCTGTTTTTGCAGGTAAGAA
CCAATGGTCAGAGATGTTTGTTATGAAGGAGGGTGTTGATATTTGGCCGT
ATTGGGATAGTATTCTTGCTGATGAGATAAGAAATGATAATCTTGATCTT
CTTGAAGTTCCTCAATACGGGCGAAACCTTAATGAGACTGGTTGATTGGC
TAAATACGAGTTGCTTTATGTTGAGTAATGTTATGCTTTCAAGAGTTTGT
ATTTCATAAACAAAGTGTGGATTTGGTACCTCAAAATGCAATTTTATATC
ACTTTGCATGAAAGACATATATGAAATACGTAGTATTTAATAAATAAGCA
TAGCGTTACTCTTCTGTATTAAATAAATAAAAGACTTGTACTATTGCCAG
CAGTTTAATTCAATAAATAAGATGATCTCTTGAGATGTAAAAAAATATCT
TTTGATTGCATCATGTACTTTAGTTTTCCTAAAAATAAAAAAGGTTGATT
GTGTGTTGAANNANNNNNNNNNNNANAAANAANAAAANAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAANAAANAAANNANAAAAAAAAAAAAAAAAAAAAAAAAGGGGGGG
GCCCCTCTAAAGGGTTAATGTTTGGGTCCCGGTGGCAGGGGCACGGTGGT
TTTTTTTAAAGGGCCCAAAATTTTAATTCCCCGGGGGCCGTTTTTCAACC
CCCGGGGAGGGGAAAAAACCGTGGTTGACCCCAATCTTTCCCCCCTTCTA
ACTCCCCCCCCTTTCCCCGATGTGGGAAAAAACCGAAAGCGCGCCCCCCC
CCCCCCCCCTTTCCCCCACTTGGTGCGCGCCCAGCGGGATGGGGGGGGGG
GCCCCCCGC
back to top