EY684959

Overview
NameEY684959
Unique NameEY684959
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length874
Libraries
Library NameType
Sweet orange bark, greenhouse plantcdna_library
Properties
Property NameValue
Genbank descriptionCS00-C2-003-005-H01-CT.F Sweet orange bark, greenhouse plant Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY684959 ID=EY684959; Name=EY684959; organism=Citrus sinensis; type=EST; length=874bp
ANAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAGAAAAAAAAATAAAAAAAGAGCAAAACTAACAAAACGGGTCCATGCA
AAGGAATGACGTCTTGTATAAGAGACACCTAAATTCAATTCGCTGGCACG
ACGTGGTACCACTGTTTAGACGGGGGGGGCCCTGATGAATGGCAACTTTT
TGTGCCTTGCCCCTTTCCCCCCTTTTGCCTTCTTGCCGTGGTACCAAATA
CTGCTTTCCCGGCCCCCTTTCCCAACCCGTGGGCCGGGGGAAAGGGGGGT
GCCACCCGATTGTTTCCCGTGAGTGGCCCTCCCCTTTTTGCCTTGGGGGG
GGGAAATCAAAAGGCCCCCCCCCCTTTGGCCTTCCCAAGTGTGGGCTCCC
CCTTGGGGGGGAGTGGGTCCCCCCCCCCCTCCCCCCCTTTTCGCCGGGGG
CGGGGGTGTGCGCGCCCCACTCTCCGACCGCTACTTCTGTCCAGCACCCC
CCCCCCACGCCCTTCCTTTCTTTCTCCGAATGATGAACCAGACGACGCGG
AGATATTTCGCCCAAAGAGCTTACCCCCCCGGGACCCCTCACACTCCCGC
ATTCACTCTTCCAACACGAGAAGCTCCGCAGGCGCAGGCCCGCTGGGGAG
GGGAGTGGACGCAAGGGGGTGCCCCGCGCACGAGCGACACGGTGACCGGC
CCGCAGCCCCAGAAGCGCCCACCAGACCCGGCGACCGAGCGCCTCGCCAA
ACACCCCGGCCCACACCATGCACCCGCACTCCCTCCAATCCAGAGACAGC
CCCGACACGCAACACCGGACAACTCCGACCCGGACACCAAAGAGGACCAC
ACACACCCCGCCGCCAACAAGACC
back to top