EY684765

Overview
NameEY684765
Unique NameEY684765
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length921
Libraries
Library NameType
Sweet orange bark, greenhouse plantcdna_library
Properties
Property NameValue
Genbank descriptionCS00-C2-003-003-D03-CT.F Sweet orange bark, greenhouse plant Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY684765 ID=EY684765|Name=EY684765|organism=Citrus sinensis|type=EST|length=921bp
CTCGATTGCCTTCTTGACCTCTGGGCGCCGTCTTCGAAGATAGCATTCCC
CTGATGAGCTGCGACCTGTCATATGGTGATGTACATTGATCGTCATGTTG
CTCCAAACCGGAGGAATGCTGATGTGCTCATTATGCACTGCTCTCTTGAA
AGCTTATTATCAATATTCTCGTATGACTATTTATGGATGGAGGTGACCTA
TGCTGAGGCTCAAGAGTGTGTATGAGTGATGTACACAGTGATGTTTGAAT
TACCTCATTCCTTACCTCGTTCTATCATCACCCCTTGCATTCTCCCTCAT
CATGAGGTAGCTTAAGGTCTATTTTGATCTTCAAAAGAAAAGACCAGCGC
TCAACCAGATAATGCTGTCCCCAATCTTGTGTGCTATCGCCATATTTTGG
CTGAATGCGGCCCTAATTACCACTGAATGACCTTTCCTCACGAGGCAGCT
TGCCTGACATGACTATCCCGAGGATCATCTACCTGTTTATCTGGCTCGAC
CCCGATCTCCGCGGGAGAACCACAATCCTTGCAATTCCCCATCTGCCCCA
CTTTACAGCATGACGTTGCTTAAAGGATGACCAAACGAAAAAGGATCACC
CTCCAGCACCGCACCACCCACATAAGACACGAAACCACCCAACCAAAACC
GAGCAAGACCTCACAGCAACGCCAGCACCCGGCAGCCCGCAACCAGGCGC
GCAGGTGGAGACGCCCCAACGGCCGACCCAAGGAGACCCGCCACTCCCCG
CCCGCACCGCTCACACCACACACAACCAGGAAGAAAACAACCCCCCAAAC
TAACCCGCAGACACCCACCACGACACCCCAGAGACCACTAACCCAGACCC
CCCGCCGAACAACCAGAAGTGAAACCCCACACAGCCCCACCAAGAGCGGA
CACAGCCAAGACCCCGCAAAA
back to top