EY684756

Overview
NameEY684756
Unique NameEY684756
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length895
Libraries
Library NameType
Sweet orange bark, greenhouse plantcdna_library
Properties
Property NameValue
Genbank descriptionCS00-C2-003-003-C04-CT.F Sweet orange bark, greenhouse plant Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY684756 ID=EY684756|Name=EY684756|organism=Citrus sinensis|type=EST|length=895bp
CGGACGCGTGGGAAAAGAAGGGACTGAAGGAGAAGCTCAAGGAGAAAATA
TCAGGTGAGAAAGAAGAGGACACGACAGTCCCTGTCGAGAAACTTGATGA
TGTCCATGCTCCCCACCACCAGGAAGAAGCCCATCCTGAAGAAAAGAAAG
GATTTCTCAACAAGATCAAGGAGAAACTACCAGGACAGCAAAAGAAACCT
GAAGATCATCAGGTCCCTTCTCCTCCTGCTGCTGAGCACCCCACATCAGT
CGAGGCTCCTGAGGCAGAGGCCAAGGAGAAGAAGGGCATATTGGAGAAAC
TCAAGGAGAAGCTCCCTGGCTACCACCCAAAGTCTGAGGACGAAAAGGAT
AAGGACAAAGAAACTGCTGCCCATTAATTAAGAAGATTAAATTTGTAATG
TGTTTGATACAATTACTGTTTTTGCCGGTCTCCTGTTTGTGTGGTTTGTT
CAGTTCTTTCTCCTTTGTAATGCTTTTTTTTTTTTTTTTTTAAATTTGCC
TTTATTACCATTTGATTTTATGCTTAATGTATAAGTGCTGTTTATGTACT
TGGATGAATAACGTGAAATACTTTCCTTGCTGGATGAGTTCTGCGCCCAA
ACCAAGCACAAACACACCAAGACGCACAAAGAAACGCGGCACGGAAAAGA
GGAGCGACAAACAGAGAGAGACAACAAAGGAGGGGCCGGCGGTCCAGAAG
AAGCCGGAATGCAGCCCAAAGAAAAAACAGGACACGGAACGAAACAGAAC
AGCAGGACCGCAACCTACGCACCCCGACCACGCGACCCGAACCAGAACAA
TCGCCGACCGCGCCCCCAAAGACGAGGGGGGAGCAGGGCACACGGGCCGC
GCAAGAGGAGGCCGGCAACGGAACGAACGGAAAAAACACAGGGGC
back to top