EY684752

Overview
NameEY684752
Unique NameEY684752
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length887
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
EY684752_ssr503 microsatellite EY684752_ssr503:503..512. BLAST: Citrus ESTs to Prunus persica proteins V1
EY684752_ssr293 microsatellite EY684752_ssr293:293..316. BLAST: Citrus ESTs to Prunus persica proteins V1
Libraries
Library NameType
Sweet orange bark, greenhouse plantcdna_library
Properties
Property NameValue
Genbank descriptionCS00-C2-003-003-B12-CT.F Sweet orange bark, greenhouse plant Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY684752 ID=EY684752|Name=EY684752|organism=Citrus sinensis|type=EST|length=887bp
CCACGCGTCCGCCGCAAAACACCTCAAAGACGTCCACTTCATCTCCAAGA
TGGACGTGTACGCCGTCGTTTCGATCTCGGGCGACCACACCATCAAGAAA
CAGAAAGTCAAGACGCACGTGGACCGATCCGGCGGTTCAAACCCCACGTG
GAATTTCCCGATTAAGTTCACCTTCAACGAGTCCTTGGCCCAGCAGAATC
GCCTCACGCTCGATTTCAAGATCAAGAGCGACGGCTTACTCGGCGATAAA
ACCGTCGGCGAAGTAATCGTCCCGATCAAGGAGCTCTTGGATTCCTCCTC
CTCCTCCTCCTCCTCCTCGGGAGACGCCCCATCGATGAAGTTCGTTCCTT
CCCACGTCCCCTCGTCGCCGCGACAACACCCCGGGCGAGTTACACTTCTC
GGAAGGGGGGGGCGGGGGGAGAACCCACCCGAAACCGAAACCCCCGGGAC
CTAAGCCAAGAAATGAAACAAAGGAAACCCACGAAAACACGAGAAAAAGG
TGACACACACACATACAACAAGAGAGAGGAAGAACATGAACGCCCAACCA
CAGACGCACCACAGCCCGCCCCACCCACCCGCCAACCGAGCCCGCCCACC
AACCCCCGCCAACCAACATCACCACCCCACAAAACAAAAACCCGACCACC
AGCCAACACCCCGCGCCCACCCACAACACCCACACACAACAGAAAACCAA
GCACAAGACCACGAAAATAGACAAAGAACGCAGAACTCCGAGCGCCGGAT
GCGAACCATCAAGGAGACCCCCCGCCCCGGCAACAGCCGCCACGGCCAGA
ACAACCAACCCCGCACCAAAAGACAAACAGCAACCCCAGCGCGAAACACA
GCACCCAACAACGACCCACACCAACACGACCTCACAC
back to top