EY684535

Overview
NameEY684535
Unique NameEY684535
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length988
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
EY684535_ssr709 microsatellite EY684535_ssr709:709..720. BLAST: Citrus ESTs to Prunus persica proteins V1
Csv1_Contig2982 contig Csv1_Contig2982:212..1199. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Sweet orange bark, greenhouse plantcdna_library
Properties
Property NameValue
Genbank descriptionCS00-C2-003-001-C02-CT.F Sweet orange bark, greenhouse plant Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY684535 ID=EY684535|Name=EY684535|organism=Citrus sinensis|type=EST|length=988bp
TCCCGTCTCGACCCACGCGTCCGCACCAGGATATGCTGAGTGTTCTTCAA
GATTTAGCAGGGATGAGGAAAAAAGATGATTTGGGGCTGATAATTGCAAC
TTGTTGGGCTATCTGGTATGCAAGAAATAGAGTGGTAAATGAAGGTAAGC
AAGAAGATCCCCAAATAACAGCAGCTCGGGCTGCAGCAACTGCAGATTCT
TACTTGAGAATTAAGTGTCCAAATGTCCAAGTTGTTCCAAGGCAGCACAA
CAATAATCAACAGGTGTGGAATCCCCCTCCAATTGGATGGTATAAAGTGA
ATGTGGATGCAGCAATTCAAATGGCAAATTCGAAGGCTGGGCTAGGTGTA
GTGATTAAAGATTCAAGCGGGAAAATTTTGGCTGCAGCAGTTCAAAGCAC
TGGATTCAGAGGAGATGTGGCTTGTATGGAAGCGGAAGCTGTGTTGTTTG
GAATTCAAGTTGGCTGCCGAGCAAAATGTGATCCGATCATCATACAGTCA
GATTCTTTAGAAGTGGTGGAGCTATCACTGCAAAGGGAAGAGCAGCGGTG
GCGCAACTTTGCTGGGGCCGTGGAACACATCCCACGATGGCTTAAAGAGC
CAGAGCCAGACCATGCCATTCCCTTCCCTTCGTACAAAACTGCACGGGAG
CGGCCTCCCTCCTTAGGAAACAAGAGTACGAAGAAAACAAAGAAAGCCTG
GCGCCCGAAAAGAAAGAAAGAGAAAGAGCACAGAAAGAGATTATAGGTAG
ATACACCGTGAGTATAGGTTATCGCGGTTGGGCGTGGCGGGAAGAAACGA
AACAGCTACAGTTATGACCGCGACCAGAGGAAAGCGTGGCCAAGCATGGA
GCAGCGGCGGATCACGAACCACTCAGTTAGAGAGCTGAGGGGGGACGGGC
GGCGCGCCTGCGACGGGGGCGCTGGCATGCGAGTCGCACCAGCGCCTCTA
CTGACCGCCCCTCATCGATTCCCACTCAGGTAGTCCGG
back to top