EY684523

Overview
NameEY684523
Unique NameEY684523
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length958
Libraries
Library NameType
Sweet orange bark, greenhouse plantcdna_library
Properties
Property NameValue
Genbank descriptionCS00-C2-003-001-A12-CT.F Sweet orange bark, greenhouse plant Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY684523 ID=EY684523|Name=EY684523|organism=Citrus sinensis|type=EST|length=958bp
TACCCACAAATGGGTTGTGGAATTGAACGGAGCTCACACTGTATGTTCAG
ATGGGTATTTGCCTGATTGCATGTTTCTTTGATCTTATTATAAAGTATTG
TAGTGTTTGTTTTTATTTATTCATTTATTTCATTATTTTTAACTTTCGTT
GTGGAGGTTTTTGTTGTTGTGAAACAAAAATTTTACTTCCAGCTACAAGT
TCATATCTCTGGTTAAGGGGATTTACTGCAAAGTGTGAGAATATTCATAT
ATGATAAAATTAAGGTTATTTGTCTAACAAATGTCATAAGGGATGCTCCT
AATCACTAAAAGATGGCTCTGCTGTCTCATGCAGTCTTTGTGAAAGACAA
CCAGAAAGAGTGTTTGGTGAAATTGCTTTTATTAAGGCTGTGCAACGTTG
GACTAGATTACTTTCTATATCTTTGACTGGATATTTGCAGAAGTCAGATT
GCCAGTCTTTCTTAACATTATGTTCCATTGTTTGGAGATTCTATTTGATG
AATCCTACTCGGGGATGAATATTACATCAGATGCGGCAAGCTTTTGAAAA
CGCACTCAAACACGCCATGACGCAATGGATGAAGGATATCATGGCTCCAA
ACAAGGGAGGCGTCGTGCGGCGCAATTGCAGATCCCAAACAGAAATCAGA
TGTCGCGCCACGCACAGCCGCGCCCCCCTGTCACCAATCTCCACCCCCCA
CACCTCCCTCGCAGGACAGCCAACACACGAACTAGGAGGCCGCGGCTCGC
CGCGAAGGCGCGACCCTCACCCGGCCACGGGCAACGAAGCGCCGCGCCCT
ATCACCCACCCGAGGCCGAGGGCGGACGCGGACAACCGCCGGGGTGTCCA
AAATTAGCAACGAAACCCTAATAATACTCAAGCAAGACCCCGACGACCCA
GGAGCCCAGGGAAAGAAAACNATATGAGAAGACAAGACAGAAAAGACAAT
ACACGAAG
back to top