EY660168

Overview
NameEY660168
Unique NameEY660168
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length778
Properties
Property NameValue
Genbank descriptionCS00-C1-101-019-C07-CT.F Sweet orange leaf, infected with Xylella fastidiosa (stage 1 of 2) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY660168 ID=EY660168; Name=EY660168; organism=Citrus sinensis; type=EST; length=778bp
CCACGCGTCCGGCCTCCAGAAAGTGGCGCTAGAGAACTTGATGAAGGATT
TTGGGAAGAGTTACTGAATGAGAGGTTCGAAGGAGAATTAGATATGCCTG
GTAGCGAAGTGGGTGATGATGAAGATGTCACTGTATTGATTGATCGTTTT
GGTTATCTGGGTTCAAGTCCAAAGCAATAGCAGAGCAGTTTTACCATCAG
CATTCGGCATCAGTTCATTGCATGGATGATTATCTCCTTCTGGTAGCAGG
CTCTTGCGTACCGGCTGTTTGTATCTCCTCTTCTACTATTTGCATCTCTT
GAAATGCCATTAGGCCATAATTTTCACCTTGATTTCTTGATACTGACAGG
ACAGAAGAGCACTGTATCACTGGAAAGTGTTTTGTTACTGGTTTTTCTAA
CCCTGTATTATTCTATTTACTAGTCCCTGTTTCAATTTCGTACGGCCTTT
TTCCGTTAATTTGTTCTCTATCTTGGTTAATTAGGTCGAAGCAGTGCCCG
GAAGAATTTGTGGTAGTCTCTATCATGATGTATCTCAAGATTGTTCTGAA
GCTGTTGAAATGGACAAAGATGTAGCTGCCTTTTCCTGGAACCACAATGT
ACATGTTGCTACTGGAACCAAGAATCATTCGTAGACAGTTGGGGTCGGTC
CAATACATTTATTTTTGCATTTGTCTTTATGATCTTTTTTTCTGAGAATT
GATAGAACATGNTGTTGGTGACNAATATCATGATACTACTANCATGTAGA
TTTTTTCATCTGGGCAAAAAAAAAAAAA
back to top