EY660161

Overview
NameEY660161
Unique NameEY660161
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length932
Properties
Property NameValue
Genbank descriptionCS00-C1-101-019-B12-CT.F Sweet orange leaf, infected with Xylella fastidiosa (stage 1 of 2) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY660161 ID=EY660161; Name=EY660161; organism=Citrus sinensis; type=EST; length=932bp
TCCCCGACCCACGCGTCCGAGCAGTCTCCCACCGCGTAAGTAAGAAGCTC
AATCTCAAAGCAATGGATCGGAAGACTGTACTTGCATTTGCATTGATGTG
CGTCATTGTCGCCGGTGTCGGCGGCCAATCCCCGGCTGCTGCACCAACAA
CAGCTCCTGCAAAGGGTAGCAGCCCAGCAAAAGCTCCATCCACAGCTCCT
GCAAAGGGTGGCAGCCCAGCAAAAGCCCCATCCACAGCTCCAGTGAAAGC
CCCCGCTAAGCCCAAATCACCAGCTCCCGCCGCTGTTCCAGCAGCTGCTC
CCCCATCTACAACCCCTGCAAAGGGTGGCAGCCCAGCAAAAGCCCCATCT
ACAGCTCCAGTGAAAGCTCCCGCTAAGCCCAAATCACCAGCTCCCGCCGC
TGTTCCAGCAGCTGCTCCGTCTAAACAGGCTGTCCCCGCTCCGGCAGCAG
CTCCCACATCGACTCCTCCGGCGGCTACTCCAGTGAGTTCGCCTCCAGCT
CCGGTTCCAGAAGCGAAATCACCTCCAGCACCTACTCCTAAAGCTGCGCC
GGAGACTTCACCAGCGGCTCCATTGGCTTCGCCCCCGAAAGCCGAGGTGC
CTGCGCCGGCTCACAGCAAGAAGAAGTCAAAGAAGCACCATGCCCCAGCT
CCTTCCCCGGCTTTGTTGGGCCCGCCAGCACCACCGTCGGAGGCTCCGGG
ACCGAGCGCCGACTCAATGTCTCCCGGTCCATCTGTCGCCGACGACGAGA
GCGGCGCAGAAACGATCCAGAGTGTGCAGATAATGATGGGCGGGTTGGCA
TTGGGATGGGGTCTGCTAGCTTTTGATCTCTAGAGAGAGATGTACCGTCG
TTATTATTTTGAACTTCTTTGGCCATTTTTAACCCTTCTGGTCACTCTGC
TATAACCATTTGAAAATAAAATTTTTTAAATT
back to top