EY660160

Overview
NameEY660160
Unique NameEY660160
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length894
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionCS00-C1-101-019-B11-CT.F Sweet orange leaf, infected with Xylella fastidiosa (stage 1 of 2) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY660160 ID=EY660160; Name=EY660160; organism=Citrus sinensis; type=EST; length=894bp
CCACGCGTCCGGCAGTCCAGTACAAGCAGAGTGACCCACTTACTCCACAA
ACGACTGTCACTGATTTCTGTGTGTGTTTCAGCTGTTGCCCAGTTTCAGA
GTTTTCACTAACACATGCAACAAAATAATTTAAAAAATATGAAATTGTTC
TTGAAATTCTAAAGCTAAAGAAACAAGTACTGATCTCTCTTTCTGCAAGT
TTTTGGCTCAAAGAGCCATGAAAGGAACGCATCTTCTCCTCACTTTAACT
CTTTTGATCGCTTTCACTCTTCAATTCCAAGCTCATGCTGCCCCTGCAGG
GCCTTTGATAAAGCACTTGACTTCTCTTCTTAAGTGGACAACCAGGTCAT
CTTCCAAAGCACCTCAAGCAGATGGGAACGTTCTCCAATTTGAGAACGGT
TACTTGGTTGAGACGGTTATTGAAGGAAATGAGATCGGGGTGGTTCCTTA
CAAGATCCGTGTCTCTGAGGATGGCGAACTATTTGCTGTTGATGAAGTTA
ATAGCAACATTGTGAAAATTACTCCACCATTGTCCCAATATAGTCGGGGT
AGATTGGTTGCTGGGTCATTTCAGGGTTACACAGGGCATGTTGATGGAAA
GCCAAATGAAGCTCGTTTTAATCATCCAAAAGGGGTGACCATGGACGACA
AAGGGAACCTGTATGTTGCTGATACTTTGAATCTTGCTATCCGAAAGATT
GGAGATGCAGGTGTGACAACCATTGCTGGAGGGAAAATCAATGTTGCAGG
TTTCAGAGATGGACCTAGTGAGGATGCTAAGTTCTCAAATGATTTCGATG
TGGTGTATGGTCGACCCACCTGCTCCNNTATAGTTATTGATAGAGAAATG
CAGCTCTTTCGCAATCTCTNCTCATCAGATGACTGTGATATCAG
back to top