EY660158

Overview
NameEY660158
Unique NameEY660158
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length167
Properties
Property NameValue
Genbank descriptionCS00-C1-101-019-B09-CT.F Sweet orange leaf, infected with Xylella fastidiosa (stage 1 of 2) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY660158 ID=EY660158; Name=EY660158; organism=Citrus sinensis; type=EST; length=167bp
CCACGCGTCCGAATTGAGAAGGGTGAATGATGAATTTCTGTTTTTTTTTC
CAGTTGCCTATAAACGCGCGGGATGAAATATTTGTAGTGTGTTGTTTTTA
AGTGATTGCAAATTTGCCATTGATAATATTATAGACTCAATTTCAGTCAA
AAAAAAAAAAAAAAAAA
back to top