EY660152

Overview
NameEY660152
Unique NameEY660152
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length354
Properties
Property NameValue
Genbank descriptionCS00-C1-101-019-B03-CT.F Sweet orange leaf, infected with Xylella fastidiosa (stage 1 of 2) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY660152 ID=EY660152; Name=EY660152; organism=Citrus sinensis; type=EST; length=354bp
CTAGTAAGGGAATCGATTGCAACCAATTTATTGAGCCTGAAAACTGAAAA
ATGAATGCCCTTCACGGGTTCAAATAATTAAAAGAACTCGCATTTACCTT
ATGAACACATTCCTATCGTGTGAATTAAAATGTAAAATAACAAAATATGC
TTGTGTTTCTTCTGTGCTCTGTTTACATGGGCGTTGAATTTGTATTATAA
GATTGGTTGAATAAGCGTTTGCTGCTGTAATATATGGTGTATCACAATGT
ACAATAATGAAGAAACAATGGTCGCAGTGGTGTGCCTTAAGATCTTTGTA
NAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAANNNNNAC
AAAC
back to top