EY659952

Overview
NameEY659952
Unique NameEY659952
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length889
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
BLAST: Citrus ESTs to SwissProt2010-05-10
Homology
BLAST of EY659952 vs. ExPASy Swiss-Prot
Match: PAO_ARATH (Pheophorbide a oxygenase, chloroplastic OS=Arabidopsis thaliana GN=PAO PE=1 SV=1)

HSP 1 Score: 79.337 bits (194), Expect = 3.164e-14
Identity = 69/277 (24.91%), Postives = 116/277 (41.88%), Query Frame = 3
Query:   45 VSTIHELPYDHFILLENLMDPAHIPISHDRTDYSAKREDAQPLGFEVTERTDRGFAGQWGREKDGSMPNFLRFEAPCVLQNNRESVDNKTGEKHYSTGLFLCR---PTGQGKSMLIV-------RFGTTGTSPWIKLFPDWYFHQSASKVFEQDMGFLSSQNEVLLKEKVPTKE---------LYFNLRSIDTWVAEYRKWMDKAGHGMPYYFGHSTISLPKVPAVVEHAPAGLVAGVSASLPAKGGIGNMHAPNLXNRYFRHVIHCKGCRSAVKAF 818
            V+   +L Y +  L+EN+ DP+HI  +H +   + +R+ A+PL F+V      GF G      D S     +F APC   N  E         +    +++C    P   GK+  IV       +F   G + W ++ P WY H +++ V++ DM  L  Q +V L + + + +         L F     D +V  +R W+ + G   P +FG ST S   +P+ V                       +    + +R+ +H   C  C+ A  +F
Sbjct:  230 VTIQRDLFYGYDTLMENVSDPSHIDFAHHKV--TGRRDRAKPLPFKVESSGPWGFQGA----NDDSPRITAKFVAPCYSMNKIELDAKLPIVGNQKWVIWICSFNIPMAPGKTRSIVCSARNFFQFSVPGPA-WWQVVPRWYEHWTSNLVYDGDMIVLQGQEKVFLAKSMESPDYDVNKQYTKLTFTPTQADRFVLAFRNWLRRHGKSQPEWFG-STPSNQPLPSTV-----------------------LTKRQMLDRFDQHTQVCSSCKGAYNSF 475          
The following BLAST results are available for this feature:
BLAST of EY659952 vs. ExPASy Swiss-Prot
Analysis Date: 2010-05-10 (BLAST: Citrus ESTs to SwissProt)
Total hits: 1
Match NameE-valueIdentityDescription
PAO_ARATH3.164e-1424.91Pheophorbide a oxygenase, chloroplastic OS=Arabido... [more]
back to top
Properties
Property NameValue
Genbank descriptionCS00-C1-101-016-H07-CT.F Sweet orange leaf, infected with Xylella fastidiosa (stage 1 of 2) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY659952 ID=EY659952|Name=EY659952|organism=Citrus sinensis|type=EST|length=889bp
AAGAGGCGGCGTNCGGAGAACTTTGCCTAAAAGGGGTTCAAGATGTCTCA
ACAATCCATGAACTTCCATATGATCACTTTATACTCCTTGAGAACCTCAT
GGATCCCGCCCATATCCCAATCTCACACGATAGGACCGACTATTCTGCTA
AAAGAGAAGATGCCCAACCCCTTGGCTTTGAGGTGACTGAACGTACAGAT
CGAGGATTTGCAGGCCAATGGGGTAGGGAGAAAGATGGGTCAATGCCAAA
CTTTTTACGCTTCGAAGCACCATGCGTTCTCCAAAACAACAGAGAATCAG
TTGACAATAAGACGGGAGAAAAACACTACTCCACGGGTCTATTCCTCTGC
AGACCAACCGGACAAGGGAAATCAATGCTTATTGTGCGGTTTGGAACAAC
TGGAACATCTCCCTGGATCAAGTTGTTCCCTGATTGGTACTTCCATCAGA
GTGCAAGCAAGGTTTTTGAGCAAGATATGGGGTTCCTCTCCTCCCAAAAT
GAGGTCTTATTGAAAGAGAAAGTTCCCACAAAAGAATTGTACTTTAACTT
AAGGTCCATAGATACATGGGTGGCCGAATACAGAAAGTGGATGGATAAGG
CTGGGCATGGAATGCCCTATTATTTTGGGCACAGCACAATTTCTCTGCCG
AAAGTACCCGCTGTGGTCGAACATGCACCAGCTGGTCTTGTTGCCGGAGT
TTCAGCATCTTTACCAGCAAAGGGCGGGATAGGAAACATGCATGCTCCAA
ACTTGGNCAACCGGTATTTCCGGCATGTAATACATTGCAAGGGATGCAGG
AGTGCAGTGAAAGCTTTCACACTTGGAAAAATCACTCTCACAGCGGCTGC
TCTACTGACTGGCNTGGCTATCCAGGGGCTGGAAGCAGG
back to top