EY659688

Overview
NameEY659688
Unique NameEY659688
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length912
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig7493 contig Csv1_Contig7493:1..912. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionCS00-C1-101-014-A05-CT.F Sweet orange leaf, infected with Xylella fastidiosa (stage 1 of 2) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY659688 ID=EY659688|Name=EY659688|organism=Citrus sinensis|type=EST|length=912bp
CCACGCGTCCGAGATCTTACTGCCTTTACTGTCGGTGGAGATGCCAGACA
TCTAAATCTTCTTCCTCAGGAATCTTCCACTACCCTCAGTCTTAAACAAC
CCATACTCGTCATTTCTGACAAAATCGCTCAACATTCAGCTCATTCTCAG
TCTCAATCTCAAGGGTCATGGGAGCATAAATCTGCCAGAGTCTTATCTGC
TACAACTAATGGACTTGATCAGTCTAAAACAGATAATCCTATCAGACAGG
TCACTGATCTAACCAAAACCCAAATCAACAAGCATGCTGACCAGGAGCAG
ATTAAGGCATCTGACAATCACATTTCTGCCCATCACTCTCAAATTTTGAT
TGTTGGATACAGCTTATCATTTTTCCATTGGTCTCAAATTGACCTACTCC
CTTTTTTAGTTTTCTTTTTCCTGCCTGGACAGGGAAGCCCCTCTATGAAC
TCAGAGGCTAACAGATAAATAATTGCTGAGCTCAATATAAATTTTGAACC
ATCAAGTGCTCTAGCATCATAAAAATATTCTCGTTTGCAGTATATCAAAT
AGTTTCTTGAAAGAGCACACTTTCAAACCTTGTGGATAAAATGAAATCTT
GAATCTAATTTAGATTTAATCTTTTTTTTTTCCTGATCCACATTTGTTGA
TTTTCTGCCTATATAGGATACAAAGCATCAACAGGAATCATCTCTTACAT
ATGGTGGTTTTGGAAAAGAAAGAGCCCCCCAAAATTAACAATGAGAAACA
GACTGAACAAACCACACCGCCAGAATTTCGGGTACGTCAGCTTAAAGATC
AGCTCATCAAGGCAAAAGTCTATCTTTCCCTTCAGCCATTGAAAACAATG
CAAATTTTTGGAAGGAGCTTCAACTGCCCATTAAAGAAGGTCAAGTGCAC
CTGGGGATGCAA
back to top