EY659684

Overview
NameEY659684
Unique NameEY659684
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length686
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig10290 contig Csv1_Contig10290:461..1144. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionCS00-C1-101-014-A01-CT.F Sweet orange leaf, infected with Xylella fastidiosa (stage 1 of 2) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY659684 ID=EY659684|Name=EY659684|organism=Citrus sinensis|type=EST|length=686bp
AACCCACGCGTCCGAAAACCGGCGTTGCAATTAGCGCGGACAAAGGCAAA
AATGGACAGTGTCCAACGGATGTTATCCAATTAAGTCCTAAGGACAAAAG
GGGAAAGAATTTAGGTTTACTTCCGTATGACAATTCCACAATTGTCCGGG
AATCCACTAATATTAAATTGAAATTCTCAAGAGTTTCTTCTCTTCAGCAG
TGTAACAAAGATTCGTTGTGGAAAGTTGACAACGATAACGCTTCATTAGG
AAAGCAGTTTATAACAATCGGTGAAGGTAAAACGTGTCAAAATTTTTTTA
AACTTGAGAAAGTTAGTGCATCAATATTTGATATGAAAATAGCACTAGAC
ATTCCCTGTCTATACAAAATTGTTCATTGTTCAACACTTGTTAATGGTTC
TTGCGATACACTCTGCAAAGACGTTGGCGTTTCTAATGTGGATGGCGTCC
AACGTCTAGTTGTGGTTGATGATAATGATCAGCCAAATCTGCCTTTGCCT
GTTGTGTTATTTCCAGCTGATAGTGGAAGATCTATGTTATTTCCGTCTCT
GTAATGAATAAGCCAACAGGCTGTATTATTCTAAATAATGGACCAGGCTA
GTACTCTTTAATCTCTATGGNTAAGCATAAATAAAATAGCCTATGATGCT
TTCGCTGTTAAAAAAAAAAAAAAAAAAAAAAAAGGG
back to top