EY659679

Overview
NameEY659679
Unique NameEY659679
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length903
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
EY659679_ssr525 microsatellite EY659679_ssr525:525..536. BLAST: Citrus ESTs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionCS00-C1-101-013-H08-CT.F Sweet orange leaf, infected with Xylella fastidiosa (stage 1 of 2) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY659679 ID=EY659679|Name=EY659679|organism=Citrus sinensis|type=EST|length=903bp
CAAACTTTAATATTTGATTTTCCCCTGTTTTTGCTCTCTTTAAATAACCC
TTTTTATATATTTGTAGAGATTAGGGATATACAAAGAAAAAAATACCACA
TTCGTCCCGGATCATACATAAATTTTCTGTTTTCTCGTGAATTAATGTCT
GAGATGGAGAACAATCATCAGACGTTTTGGCAATTCAATGATCAACTGAG
GGTGCAAGCATCAAACTTGGCTAATCTGTCACTCAACGACTCTATCTGGA
GCAACAATTATGGGTCGAAGAGGCCGGATGAAAGGAAGAATTTCGACATC
AAAGTCGGCGGTCAAGTGAATGTGAATCCATTCACTAAAGGGTCTGATTT
GAACGCCTTCGATGGTGGCTACAAAAGTATCACCAGCAACTACAACGATA
TTGGCCTATGCCCTATCGGCCAGATTGTGGCCCCTGCCTCGGCCTCTCAA
AATAATGTTGGGATCAACGGTGGATTCAACAAATGGATTTATTCAAAGTC
ATGTCATTTTGGTCTTATCACCATCAACAACAACAACATCATCAGTTATA
TGAATGTTAATTTGAAAGGGAATACGAATAAGGAAGATCGTGATCATCAT
GGACTTGGAAGCAAGAGTGGCAAGAAGAACAGCATCTAGAACAACACTAT
CAAAGATGGTGAGCATAATTCCGATAATATGGACACTAACACTGCTGCTG
ATAAGAGGGTCAAGACTCTCACACCTTTCGAGGCCTTGCCTACAAACTAA
ACCATAGGTGGCTATATTGTTGTCTGCACAATGATACCATGGCTGAAAAT
CTAAAAGACAGCTCTCTGGATTGCCTCACGTACAGGGATTCATGTGAGCT
TCACCCCTGGGTAGCCCTTTTCCTTGATACTATTCCCCCACCGCTGCATG
AAT
back to top