EY659657

Overview
NameEY659657
Unique NameEY659657
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length891
Alignments
Feature NameTypeLocationAnalysis
EY659657_ssr643 microsatellite EY659657_ssr643:643..654.
Properties
Property NameValue
Genbank descriptionCS00-C1-101-013-F06-CT.F Sweet orange leaf, infected with Xylella fastidiosa (stage 1 of 2) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY659657 ID=EY659657|Name=EY659657|organism=Citrus sinensis|type=EST|length=891bp
GGTAACCAAGATCGAAATTTATGGCGCGTTCAATGAAGGGATCCATACTA
TACTATGTCTGAACCGAGGGATCCATGAATACTTGGGAGAAAATATACGT
CATATTGTGAACACTATCCTAATATGAATAATCATCCAACAGATAAGAAT
GCTTATATACACCAACAATACACAGAGATAGAGAGAGGTCTGAAAAGAGA
TACCATGGCGCTTTGGGAGATCGCATTGGGAACAGAGTATTTCTTGGGGA
TGAAGCGGACGCACAGGCTTGCTTTGAAGATTGATGGGCGAGTTATGAGG
CCTAGCACCCACGGATTCAGCAATGAAGCTCACCGGTATATTGGTGTCAC
TGTCGACGCTGTTATTATATGATTATCACATTTTGCTGGCAGACCGATTA
TCATTAATGTGGACATTGATGGGGTAACCATCAATAAGTCTATTAGCAGA
TGGGTTTAATTAAACTATGCGGATGAAAGGGCTACTATTCAGACATGGGA
TCTGCATCGTTGCTCATCTCCGAAGTAATAGCTGTCGCTTGGTGCATCAA
AATAACAACAGAGGGCGGTCTGCTATGATGATCCAAGCTACTATCGCGTG
CGTGCGACGATATAGCTCTTACTGATGGTGGACTAGCTCTATCTGACTGA
CTGAAGCCTGACAACAGATCGACTGGTAACATGCCTGCTGTTACCCATGT
TAATCGGCTAGTCACACATCCACCATTTCGCAACTGCCGTAATAGCTAAG
AGGCCTCGACGGATCGGCCTTGACACCATTGCGCAACCTGAATGGTGATG
GGGACTCACCTGTAATGGGAACTGGACGCGGGGTCGTGGGTGACTCNCTC
AGCGGATCTTTTAACTGGCCAACGCCTAAGGACCGGGCGTT
back to top