EY659655

Overview
NameEY659655
Unique NameEY659655
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length146
Properties
Property NameValue
Genbank descriptionCS00-C1-101-013-F04-CT.F Sweet orange leaf, infected with Xylella fastidiosa (stage 1 of 2) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY659655 ID=EY659655|Name=EY659655|organism=Citrus sinensis|type=EST|length=146bp
CGAGCGAATGAGAAGTATAAAGGTGATAAGCCTGAGAACGATTGATGTTT
ATTGCTGTAAAAACACAATCCTTGATATTCAGGGGCAAGAAGGGGGAAAA
TGATGAAAGCAAGTTTCTTTTTTTGAGAAGGAAAAAAAAAAAAAAA
back to top