EY659622

Overview
NameEY659622
Unique NameEY659622
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length652
Alignments
Feature NameTypeLocationAnalysis
EY659622_ssr552 microsatellite EY659622_ssr552:552..563.
Csv1_Contig10290 contig Csv1_Contig10290:625..1255. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionCS00-C1-101-013-C05-CT.F Sweet orange leaf, infected with Xylella fastidiosa (stage 1 of 2) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY659622 ID=EY659622|Name=EY659622|organism=Citrus sinensis|type=EST|length=652bp
AGGCTCCGGTGCCGGNATTCCCGGCCTCGACCCACGCGTCCGAANATTTT
TTGTGGAAAGTTGACAACGATAACGCCTCATTAGGAAAGCAGTTTATAAC
AATCGGTGAAGGTAAAACGTGTCAAAATTTTTTTAAACTTGAGAAAGTTA
GTGCATCAATATTTGATATGAAAATAGCACTAGACATTCCCTGTCTATAC
AAAATTGTTCATTGTTCAACACTTGTTAATGGTTCTTGCGATACACTCTG
CAAAGACGTTGGCGTTTCTAATGTGGATGGCGTCCAACGTCTAGTTGTGG
TTGATGATAATGATCAGCCAAATCTGCCTTTGCCTGTTGTGTTATTTCCA
GCTGATAGTGGAAGATCTATGTTATTTCCGTCTCTGTAATGAATAAGCCA
ACAGGCTGTATTATTCTAAATAATGGACCAGGCTAGTACTCTTTAATCTC
TATGGTTAAGCATAAATAAAATAGCCTATGATGCTTTCGCTGTTAGTTAA
TCTCTACCCTAATTATGTGTACATTTTTTAAAAGTATTGTTATATAGACT
CCATGCATGCATGTTGTCAATGCTTTATAAATGTTTTGTATACATATTTA
AAATAAGAAGATAGACAAATACATTGCCATAAAAAAAAAAAAAAAAAAAA
AA
back to top