EY659557

Overview
NameEY659557
Unique NameEY659557
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length472
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig12654 contig Csv1_Contig12654:59..530. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionCS00-C1-101-011-E02-CT.F Sweet orange leaf, infected with Xylella fastidiosa (stage 1 of 2) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY659557 ID=EY659557|Name=EY659557|organism=Citrus sinensis|type=EST|length=472bp
GAATATTTCTCCAACAATGGCTGTGAGGGAAGACGAAGTTGTTCTAAGGA
AGATAAATGAAGATCTGGAAAGGGAATTGAAAAAGAGCAAAGAAAGAGAG
GACCAAATGAGGTTGGAGCTACAACGGGCATGTGAGAGACTGCGCTTGGC
TGAGGACGCCGAGGAGAGACTCTGTTCACAGCTGGGCGAGCTCGAGGCCG
AGGCCGTCAATCAGGCGCGTGACTACCACGCTCGCATTCTTTCCCTCGTG
GACCAGCTCTCCCAAGCTCACCAACTCCTCCTCCACCACCTCCACATCAC
CACCACCGCCACGGCCACGGTCACAGCCACACAGTTTTAGCCTTTTTAAA
TACTTTTATTATTATTTTATGTAATTGTCGTTGTATCAGCAGCTTTTTAA
TTAGCAGTTCAAAGGCTCAATCATGTGTAGTTTAAAAATTTTTGTAATTA
TTGGAATAAAAAAAAAAAAAAA
back to top