EY659503

Overview
NameEY659503
Unique NameEY659503
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length950
Alignments
Feature NameTypeLocationAnalysis
EY659503_ssr50 microsatellite EY659503_ssr50:50..61.
Properties
Property NameValue
Genbank descriptionCS00-C1-101-009-H02-CT.F Sweet orange leaf, infected with Xylella fastidiosa (stage 1 of 2) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY659503 ID=EY659503|Name=EY659503|organism=Citrus sinensis|type=EST|length=950bp
GNATTTCAAGACCCGACCCACGCGTCCGACAAGCTTAGTGCATTCAATAA
TTCATTCATTCTTTCCTTGAATATTTTCCCGTGTTCCATCAATTTCTTTG
CTTCGCAGATGGCCAGTGTTGAGGTTCAATCGGCTGCGGCAACATTGGTA
GAGAATGAGACACAAGAGGTGACCAACAAGAGTAGTAACGATACTACCCC
GGAAGAGGCGCCAGTGGCAGCTGCCACCGAAGCTGAGACCGCAACCAAAG
AACCAAAGGAAGAAGCAACGGCCCCAGATGAGGGTCCAGCTGCTGAGGAA
CCAGCCGCTGAGACCCCAGTTGAAGTTGAAACCAAGCAAGTTGTAGAAGA
AGCTAAGGTTGATGATGCAGCTAATGCTGCAGTGGAAGATAAAGCAGAAC
AAGTAGTGAAACCCGACCAAGAGCCTGTTACCGTTGAGGAAACCAAAGAA
GATGCCCCTAAGGCTGANGCTGAGGCTGATGCTGATGCAGCTCCGGTCCA
GGAAGAGAAACCAGCTGAAGAGGAGAAGCCAGCTAAAGCACCTGAAGAAG
CAGCTTCCACAGGAGTTCCAGTCGGCAAGACTGACTGAGGAATAGAGCCC
TATCAAAAGTCGGCCCAAGTTTATTTACTTTTTACANTATTTTTTGGTCT
AAGNCAGGCCTGGTATTATTACTATTATTAAGTTTTTTAATTANGGGTGG
GGATCTGAGGTTTGGATATTGAGCATAGGATTATGCCCAGCGATTCGATC
CCACACAATACATTAACGCACCCCTGTCGTACGCGGCTTGCTACTATTCA
TTCATGCTGAAGAGGGCCTGATTGAGGGATATTGAGGATGCCTTCCGCTA
CCTAACCTCGGGGTTGAATTGGGGGTTCCAAAAGGGCCGTCCCTGCTTAA
AATTTGATGAATGGCGAAAGAAAAAAANCTTACCTGGGGGATTATTTTCC
back to top