EY659464

Overview
NameEY659464
Unique NameEY659464
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length552
Alignments
Feature NameTypeLocationAnalysis
EY659464_ssr343 microsatellite EY659464_ssr343:343..357.
Csv1_Contig13780 contig Csv1_Contig13780:1183..1734. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionCS00-C1-101-009-D08-CT.F Sweet orange leaf, infected with Xylella fastidiosa (stage 1 of 2) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY659464 ID=EY659464|Name=EY659464|organism=Citrus sinensis|type=EST|length=552bp
TTAAGGATTTCCAANATTCATCCTTTTTCTTCAGTCATGTAAGTTGGGAA
AGTGTTTTGAGATAGGTGGCTAGGATGATCTAGTATTGTAGAGGGCGATT
GGTATGTTTTGAGATAGGTGGTCTAGGCTGATCTAGTATTGTAGAGGGCG
ATTGGTATGTTTTGAGATAGGTGGTCTAGGCTGGTCTATTATTGTAGATG
GGTGATTGGTATTATTTTTATACAGCACAGAAAAGTTTTCATTATTTGGC
TTTCTTAGTGGACACTCGGTCCACTCCTTGTAACAATTCTTTGTCTTTAA
TACAATTTACAGTTTCTTATTTTTTTTTTTTTTTTTAAAAAAAAGAAGAA
GAAGAAGGAACAGCTGCACCATCTTGTCGAGCAGTGACTTCAATTCTTAA
ATTGTAAGATGATATGTACATTTGAATACTAATATTATGTTTAGCAAGAA
GCCTTGGAGATAGATATAACTAGAGATTCATTGGATGGATCTTTGAGGAA
AAAAAAAAAAAANCAAAAAAAANNNCAACAAAACAAAACCAAAAAAAAAA
AA
back to top