EY659459

Overview
NameEY659459
Unique NameEY659459
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length557
Alignments
Feature NameTypeLocationAnalysis
EY659459_ssr511 microsatellite EY659459_ssr511:511..522.
Csv1_Contig1848 contig Csv1_Contig1848:312..868. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionCS00-C1-101-009-D03-CT.F Sweet orange leaf, infected with Xylella fastidiosa (stage 1 of 2) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY659459 ID=EY659459|Name=EY659459|organism=Citrus sinensis|type=EST|length=557bp
CCTGGTGCCGGNATTAAAAGCCCGACCCAGCGTCCGCGCTTTGCTTATTG
CATCTGGTTCTTCTAATGGTCCTAAGCCTATAGGTGATGATAAACATGAT
CGTCCTTTTCATGGCGTTAGAACTACAGTTCGATTGAACAAATTGAAATA
TGATCGTGAAGTGTTGCGCGGAGGTTCTCTTGTTTTGGAGATTAATCTTC
TATAGGTTTTTTCCGGAGGAGATGTTGTGGATTCTGATCATACTTTTGAT
GGTCAAGTGTTCTGGAACTTGTACTCGAATTGAATATTGTACGGCGAGAT
AAGTTGATGTGTGTATTAATGGTATTATCTAATATAAACATAGGATTGGA
CATATAGTTGTGTCAATGTATTGTGTAATTTAACTACCTCTAGATAATAT
TATCGTTTGTGTAATGATTGTAATTGATGTTTTGTTGGAGGATCCTTTAG
TATGCTTATAAAAAGGATTCAAGTGTGTTGTAACGAGCAGAGCTCTTCTA
AGTCTAGTCCATAAATAAATAAAAGAGTTGACTATAATGTAAAAAAAAAA
AAAAAAA
back to top