EY659453

Overview
NameEY659453
Unique NameEY659453
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length861
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
EY659453_ssr12 microsatellite EY659453_ssr12:12..21. BLAST: Citrus ESTs to Prunus persica proteins V1
EY659453_ssr24 microsatellite EY659453_ssr24:24..33. BLAST: Citrus ESTs to Prunus persica proteins V1
Csv1_Contig8245 contig Csv1_Contig8245:88..948. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionCS00-C1-101-009-C09-CT.F Sweet orange leaf, infected with Xylella fastidiosa (stage 1 of 2) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY659453 ID=EY659453|Name=EY659453|organism=Citrus sinensis|type=EST|length=861bp
GNATTTTTAGTAGAGAGAGAGANAGAGAGAGAGCACAGACATATAACCAG
TTACCCATAAGCCATGATATGTGAAAGTGCTTTTCCAACGTAGAAAGCAG
AAGTTAAAGTTAAGAAAGCACTCTCTGCTTCAGCTTCAGTTTCTTTATTA
ATTATATCCTCTCCGTACTGTCTCTGCCTGTAGTTATTTTGCTGTATTTG
AGTTCAGGAGGATGTGAAGAAGCTTTTACGCTTTCTGTTGGAATTTCGGA
GGAACTTTCCAGGTTTCCTTCGAGATTTCTTGGCCGGCCACAGCTTTCGC
TTCACTAATTAGCAAATCTTCTTTGGATCAGAGAGAGGCATCCTAAATGG
CTAATGCTTATTGGCCATACTTCGATCCGGAGTATGAAAGCTTGAGCCTC
AGAATTAATCCTCCAAGGGCGTCCGTTGACAATTCTAGCTGCCCTGAGTG
TACGGTGGTCAAGGTAGACAGTGTGAACAAACCAGGAATACTGCTGGAAG
TAGTGCAAGTTTTATCAGACCTTGACCTCATTATCACCAAGGCTTACATC
TCCTCTGATGGCGGATGGTTCATGGACGTATTTCATGTGATCGATCAGCA
AGGGAAGAAGATTACTGATGGCAAAACCATTGACTACATAGAGAAGGCTC
TGGGGCCCAAAGGCCACATCACAGCTGGAGCGAAGACTTGGCCGAGTAAA
CAAGTGGGTGTGCACTCGGTTGGTGACCACACGGNCATCGAACTAATAAG
CCGAGACCGTCCGGGTCTCCTGTCCGAAATCTCCGCAGTCCTCGCCAACC
CTCCGTTCAACCGTACCGCCGCCGAATTCTGGACTCACAACCGGCGAATA
GCATGCGTGCT
back to top