EY659442

Overview
NameEY659442
Unique NameEY659442
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length365
Properties
Property NameValue
Genbank descriptionCS00-C1-101-009-B09-CT.F Sweet orange leaf, infected with Xylella fastidiosa (stage 1 of 2) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY659442 ID=EY659442|Name=EY659442|organism=Citrus sinensis|type=EST|length=365bp
CCGGCCTCCGGTGCCGGNATTAACCCCGTCGACCCACGCGTCCGGGTGGT
TTAGGCTTTTTGATAGGATTGCTGGACCACACAGAGAAAGACCGAATCAG
AAGACTTGTAAGACTCAAGCCTCCGAATGAGTTCTAAACTGATAGCTCAA
TAGCAAAGCCACTCTTTTCACAGCACTAAAGATCTTGCTTAGATACAACA
TTGTTTCTCTTCAGACCCCGGTTGTAACTTCTTATTGTAATTTCTGATTG
GAATGTATGAAATTGCTGGATCAGTATGTGAAACTGATGACAATTTGTTA
TGAAACCGTTTAAAGGTACTGATCAGCAATCCCATAGAAAAAAAAAAAAA
AAAAAAAAAAAAAAA
back to top