EY659399

Overview
NameEY659399
Unique NameEY659399
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length678
Alignments
Feature NameTypeLocationAnalysis
EY659399_ssr459 microsatellite EY659399_ssr459:459..468.
Properties
Property NameValue
Genbank descriptionCS00-C1-101-002-G01-CT.F Sweet orange leaf, infected with Xylella fastidiosa (stage 1 of 2) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY659399 ID=EY659399|Name=EY659399|organism=Citrus sinensis|type=EST|length=678bp
CCACGCGTCCGCAACTTTGGAAGCAAAATCCCATCGACTTTATCAAGGTG
CAAACATCTACAAACATTGGCTTTGTCGGTCAATGGCTTCTCGGGAGCCA
TACCAAAAGAAATCTGCAATTTGACCAAACTTAAGAGTTTATATCTTGGC
TAAAACAGACTCCAAGGTATGTATGGTTTATATTTATGTCTTTTTTTATT
TATTGATCATGTCATTTATACCTCTGAGGCTATAATTGAAATTATTTTAG
ACTTTCTTTATTAAAATTAAAACACATTGTTTCATTGCCTAATTAAAAAT
CTAAGACTAATGGCTCTAAGGTTAACGAATGTCAAACAAGCGTAAACCTT
CTATTTATGTTTCTCTTTTCTATTGCATTTTCTTCTATTTCGTGTCACTC
AACAAATTTTGATAATCTATCAAGCAGATTAGATGTTTTTCTTTTCTTTC
TTGTTTGTTCTCTCTCTCTTTTTTAATTGTCTTTTTAGGGTCTAAAATCA
AAGCGGAGAATTAGAAAGATGGAGCAATATTTATATGTGTGTAAAGTTAA
ATTAATTTCAGACGATTGCAAATAGAAATTGTGTTCAATTGATATTGTCT
ACTTCAACTGTCAATTGTTATTGCACAATACCAAATGACATAACTTATCC
AATTTTAATCTAAAAAAAAAAAAAAAAA
back to top