EY659391

Overview
NameEY659391
Unique NameEY659391
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length795
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
EY659391_ssr446 microsatellite EY659391_ssr446:446..463. BLAST: Citrus ESTs to Prunus persica proteins V1
Csv1_Contig7475 contig Csv1_Contig7475:1..795. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionCS00-C1-101-002-F05-CT.F Sweet orange leaf, infected with Xylella fastidiosa (stage 1 of 2) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY659391 ID=EY659391|Name=EY659391|organism=Citrus sinensis|type=EST|length=795bp
CCACGCGTCCGGATGAAAAAGGGATCGTGAGGAAAGAAGAGATCCTCAAG
TGCTTCAAGGAAGTTATGGAAGGAGAGAGGAGCCAAGTGATCAAGAAGAA
TGCTAGTGAATGGAAGAAGAAGTCAGAGAAAGCTATGAGGGAAGGAGGGA
GTTCTGATCAGAATATTTGTGATTTTGTCAACGCATTGATGTGTTCTAGC
AACGGAAAACTAAAGCATTCGAACGACAATTGTGTTCAAGCTTGGATGCC
AGTTGCTAAAAGATGTCTGCGTCAAACTCCACGATAAATTAAGGGAAAAC
GAGATTCTCTCCACATTTAGCTCCACGCTTTGAACCCAACGGTGGGTTTT
GAGCTGAATACAAATTCTCCACAGTTCACGCGTCACACACGCGTTCTCCC
TCTCACCTCACGCCAAATCTCACCGTGCTCCCTTCTCACCATCGGCTCTC
TCTCTCTCTCTCTTGCCGTAGATCTCTTCACACGTGGCGTGGGTCTCTCC
ACAAATCTCACCTCGGAAATTTAGAAAATTTATGGCTTGAATTTGTGAAG
ATTCAGCTGGAATTCTTTTTATTTGTGGTGATTGTATCTGGGGTCAATTT
CTGCATTTGTAATTGATTTGTAGTGGCAAGTGAGTTTAGATTGATTAGTA
NGTGCATTTAGATTGATTTTGAGTGAAGTAAAAGAGAGTGCTCTTGTACG
GGTGAAGAGTTGATATNAAGATTAGTAATTCTGTCCATGCTGATCGCTGA
GCTTGAAAAAATTAAAATCTCAGATGCCTTGGAAAAAAAAAAAAA
back to top