EY659304

Overview
NameEY659304
Unique NameEY659304
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length599
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig7653 contig Csv1_Contig7653:499..1097. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionCS00-C1-101-008-F08-CT.F Sweet orange leaf, infected with Xylella fastidiosa (stage 1 of 2) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY659304 ID=EY659304|Name=EY659304|organism=Citrus sinensis|type=EST|length=599bp
CCANATGATAACCATATTGGCATCGACATAAACGGAATCGAATCAAATCC
AGTTAATAGTCTGCTTGACGTTGATCTCAAAAGTGGACGAGCAATCCAGG
TTCGAATTTATTACAATCCAGACTTTGGACAACTCTCTGTTTATGCGGCA
TATTCGGGGGAAACACTTGTGAAGGTGGTTGAAAAACCCATTAACCTGTC
AGATATAATTCCAACGCCCGTCTATGTTGGATTCACAGCAGCTACGGGGG
ACTTTTTAGAAAGCCATGAGGTTATAAATTGGACCTTCAACTCGTTCCCA
GTGCCGCCTTCTCTCAAGGAGAAAAACCTGGTGATGCCAATATAATTCTA
AACCGTCCTTGAAAAACCATGTCACATAAATTATAATCAATAATAATTAA
TATCACCAATAAAGTGACATGGCTCTTGCATTAAAATATTGAATAAAATG
ATAGCAGCGACTAGGATTAATACTGTTTGCTTGCTGTCTGAGATGTACTG
TATGTGCTTATGTAGAAATGCTCATATTCAGCTTCTATTGATTACGTTGC
AGCTTTGAGCTTCTNNNNNAAAAAAAAAAAAAAAAAAAAAAAANNAANG
back to top