EY659292

Overview
NameEY659292
Unique NameEY659292
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length919
Alignments
Feature NameTypeLocationAnalysis
EY659292_ssr41 microsatellite EY659292_ssr41:41..52.
Properties
Property NameValue
Genbank descriptionCS00-C1-101-008-E06-CT.F Sweet orange leaf, infected with Xylella fastidiosa (stage 1 of 2) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY659292 ID=EY659292|Name=EY659292|organism=Citrus sinensis|type=EST|length=919bp
AATTTCTTTAATGTTTACTTTATGTTGAAAGCTGCTCTACTAGTAGTAGT
AGAAGATATACTTGATGAAGATATGGACAAAAGTATTCCCATTCGGTTTG
TTAAAGTATTCTAAGAAGTAGCTCAGGTTGAAAAATCTAATGTAATGTTT
ACTTTATGTTTTATTGCCATCTTATTTAGATATGCCATAAGAAGGAAGGC
CAAAAAAAAAAAAAAAGCCATTTTCCATTTAAAGTGGATATTTGCTTTTT
GCTCAAATTTCTATATTTCGTTTCTATTTGTTGCATTTGTATAATTGTTT
TGGAATGTGGAAATTATAATAGTGACTGGGTTGTTTGACCTGGAAAACAT
GGTCTGAATTAAACCAAGGAAAAAAGGGTATGATCAACTTTCATCTACTA
TTAGAGAATTCATCGGATGCTGAACTGGTGTAATGGTGTTAGAGTGAATA
CATTTGTTCTGTGTATTAGAACTTAAGAAATGATTGGGCCTCAATCTTTT
TACTTAGCACTGAAGTAGGAACGTTCTTTTTACCAAATTTTAAAAGCTTC
CAGTGTAACTGTTACCCTCGGACAATTTTAGATACACAACGTAAACCTGC
TACGTNCAATGAATGGGNCATTTTATATTTTAGTCAAAATGATTTCTCTA
TTATGGAAACAGACTGTTGCCCTCGGGCACTTNCAATATTATTTGCAATT
ATATNNTATCTAAATCATTCATTGNCTGNNCATTGGGCAATACTGNATAG
CTATTTGTCAGTGGGTAAGGAATTCANAGACTCGTGTATGGAGGGTTAAT
ATTNCTTCCATTTTGNACTAATGAGTTATCATGCCCATTTGTTATTTTGA
TGGGNTCCCTGCAANTGATGANTCTGTGAGTGATATAAAGACGGCATCAG
TTTAGGAATCAGGATCGTA
back to top