EY659201

Overview
NameEY659201
Unique NameEY659201
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length784
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig7796 contig Csv1_Contig7796:98..884. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionCS00-C1-101-004-E06-CT.F Sweet orange leaf, infected with Xylella fastidiosa (stage 1 of 2) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY659201 ID=EY659201|Name=EY659201|organism=Citrus sinensis|type=EST|length=784bp
CCGGNATTCCAGGCCCGACCCACGCGTCCGCCGAAATCGTCGATGGCGGT
GGGCTTATTGCGTCCTTCGAAAAAGGCCATTAAGATTTACACATCTCCTG
CAAGCCAAAGGGGAGACTCAAAATGAAGAGATTGTTAGGGGAAGAACCAC
CTGGAAGAAGAAGCCGTCTTCAATGCCATTTTCAACTTAATATTATATTA
AAATAATTTTAAAAGGGATTAAGCAAAGCGGATTTTCCCGGAAAAGCAGT
GAGAAATCCTAGAATCCGATATCAAATGCCCTGGAAAAATTAAACAAGTT
GCAGGGTGTGTTATTGGAATTTGCTTTCTCCTCAGAATTTTTATGTATTT
CTGCTGCCCCTGAATGGAGCTGGAAGACAAGGGTGCCGGAAACACAAGAC
GAGTCGTGGATGGTGCAGCCAATGAAATTAAAATAAGTGGTGTGAATATT
TTGTGTGGTGATAATTGTGAGAACTGAGAAATACCTCTAAATATGAGGAA
ATTCCTGGTGATTACCTATGACTGATGGTTCAGTTCAGTGTCTGTGTCCT
CTCAGTTTGTACTATAGAAATTATTTTGTGGAAATAATGAGTAATTCAGT
ACAATGTAATTTGATGTAATCATAATGCATTCTTAAAAAATGTGATAACG
AATTTCCCCAAAAATTGGGCGTTATGGAGAGGATGTNGTATTAACCATTC
GAANTCACATAGAGCTATCTTTCGAATATCAAGACTGGNAAATGGGGAGA
GTCGGGTTCCCAAAAAAAAAAAAAAAAAAAAAAA
back to top