EY659199

Overview
NameEY659199
Unique NameEY659199
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length937
Properties
Property NameValue
Genbank descriptionCS00-C1-101-004-E04-CT.F Sweet orange leaf, infected with Xylella fastidiosa (stage 1 of 2) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY659199 ID=EY659199|Name=EY659199|organism=Citrus sinensis|type=EST|length=937bp
CNCGNATTCCACGGCCCGACCCACGCGTCCGCTTGCGCTCAATCGATCGA
CCAAAACACCATCCTTTCGCAGCCATTCAAGTATATTGTAACTATGCCGG
TAATGTTGTTTAAAAGTTATAGCCTGTTGTTGTCGGCACCATTTTGCTAG
TGGTATTGAAACCCTAGAACTAAACTCTCACCTTCTCAATTGATCGAAGA
ATGCCACCATTCTGCCCCCATTTAAACCATTTACTCTCGATTATACACTC
GTTTTGCATTGTTTCTTATTCTCTTTGTCCTTTCAGCGTCACCATCACTC
TCGTTTCACTTCGTGAAGGATTGTACTCAGTATGAACTTTGAACAGAGCA
TTGCATATATTGAAGATTACATGGTAACACATGGTCCTTTTGATGGTTTG
TTGGGCTTCTCTCAGGTGGGCACCTGAGAACTTGAACTATTTTTGGTTTT
ATTTTCTTCGAGTTTATTGCTACTTGCAGCAATTGTGTTCAGTCAAAAGA
AAGTAAGATTGGAAATTGTTGCTAGTAAATGGGGTGCAAGCTGATGTTGT
GGTAGCAGCAGATGGTACAGGGAACTTTACTAAGATAATGGATGCCGTGT
TGGCAGCAGAGGATTATAGTATGAAAAGATTCGTGATTTACATCAAGAAT
GATTTATTTGCTGGTTTGGTTTGGAATGTTGATGGGTATGTGGCTGGAAT
TANAGTGCTATTGGAAGATGGTNNGGTTGCTGGTATGGGTTGNAGTGTTG
CTGAATGTCTGCATTGNACNTGTTGAGTGTGGCTGCTGGAGTATTCCCAC
TGGAAGAAGGCATTACTGCTGGAAGTCAAGCTTAAAGGTCTGCTATTGAA
TATTTNCATTATCTTTAAAATTTTGTTGGGTACCTGGCTTGGTTATGGGG
TATAACTTAACGGGGTTGTTATATTTGGAATTTTTTT
back to top