EY659196

Overview
NameEY659196
Unique NameEY659196
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length516
Properties
Property NameValue
Genbank descriptionCS00-C1-101-004-D12-CT.F Sweet orange leaf, infected with Xylella fastidiosa (stage 1 of 2) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY659196 ID=EY659196|Name=EY659196|organism=Citrus sinensis|type=EST|length=516bp
CGGACGCGTGGGGATTAATAAGATGGTTTTAATTCATTATCCGCTGAAAT
ATTCAATTGATTTAAGCATCTTGTGCAGTGTGACCCTCGAAAGTGTTCAT
TGCTTACTGTTTGAGCAGCAGTATTTTTTTAGTAAGAACCATTTGTAGCA
GGGATGAACCTCATTTCTTCATTTTATGGATGTTGCTAACTGATTCTCTC
TAACAATTGCAGGATATTCGCCAAGCCGTCTTGAAGTTGCAGTCAAAGGT
GTCAGCGAAAGTGGTTCCTCTAACTGAAGGCTTCAAGTCGGTGTACACCT
CTTAAGTCATTTATATAGGATTCACTTTTGTTTAACGGGGGTGGGGATCT
GTAATCAGTTATTATTTTTACTTTTTCTTTTTGTAATTTTATCAGTTTTG
TAGAGAGCTTGTGATCTTAATAGGAAATCTTCTGTAATGCATCATGTTGT
TAATATGATAGAGGCATTCAAATCAAACGAGCGGTGTAAAATTGAATGTG
AAAAAAAAAAAAAAAA
back to top