EY659191

Overview
NameEY659191
Unique NameEY659191
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length767
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig12436 contig Csv1_Contig12436:499..1265. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionCS00-C1-101-004-D07-CT.F Sweet orange leaf, infected with Xylella fastidiosa (stage 1 of 2) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY659191 ID=EY659191|Name=EY659191|organism=Citrus sinensis|type=EST|length=767bp
GCTTCGGTNCCGGNATTCCCGCCTCGACCCACGCGTCCGCTGAAAAGAAA
GACTCGCTATGGAGTATTTGGCACGAAGAGAATGCGAGTACGACTCTAAG
ACCCTTGTATACTTTTACAGGGAAGGGGAGCCTTCACAGCCGGCTCTAAC
TGGGGTTATAGTTTTCACGTCTACTCCAGACAAAGTATCAAACAAGTATT
ATCTGGGGCCTGCTCCATTGGAGGAAATGGCTAGGCAAATTGCAACGGCT
GTCGGACCCTGTGGAAACAATAGAGACTACCTTTTCAAGTTGGAGAAGGC
CATGTTTGATATTGGTCATGAGGACGACTACATAATAGAGCTGGCAAATG
AAGTGAGGAAAGAGCTTGGAACTGCTGAAAAAGGAATTCTCAAGGAGAGG
AAGTTGGTTGGGTCATCATCCCGCATGCCGCTCACAAAATCTCATATTCC
AACCCTTCAACTGGGTCTACGCCCTGAGGCGGTGGCCATGGATTCATAAG
AACACAAGGCTGACAGACACCATAGGCCTAGGGGACTAATCAAAGATATC
AAGCAACGTAGCTAAACACAATCGCCATCATCTTTGTTTTCTTCTTTTTT
TTTTTCAACCTTTTTCCTCACTTTTTAGGATGAGAACTGAGTGGTTTGGA
ATTGAGAGTTGACGGCTAACCATACCAAATACATGTTGTGTAACCAAGTT
GAGGTTAATTTCAATTTCCGGCCAAATGAAGAATCCTTCATCGTTATATT
AAAAAAAAAAAAAAAAA
back to top