EY659189

Overview
NameEY659189
Unique NameEY659189
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length932
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig7493 contig Csv1_Contig7493:12..943. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionCS00-C1-101-004-D05-CT.F Sweet orange leaf, infected with Xylella fastidiosa (stage 1 of 2) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY659189 ID=EY659189|Name=EY659189|organism=Citrus sinensis|type=EST|length=932bp
AGATCTTACATCTTTTACTGTCGGTGGAGATGCCACACATCTAAATCTTC
TTCCTCAGGAATCTTCCACTACCCTCAGTCTTAAACAACCCATACTCGTC
ATTTCTGACAAAATCGCTCAACATTCAGCTCATTCTCAGTCTCAATCTCA
AGGGTCATGGGAGCATAAATCTGCCAGAGTCTTATCTGCTACAACTAATG
GACTTGATCAGTCTAAAACAGATAATCCTATCAGACAGGTCACTGATCTA
ACCAAAACCCAAATCAACAAGCATGCTGACCAGGAGCAGATTAAGGCATC
TGACAATCACATTTCTGCCCATCACTCTCAAATTTTGATTGTTGGATACA
GCTTATCATTTTTCCATTGGTCTCAAATTGACCTACTCCCTTTTTTAGTT
TTCTTTTTCCTGCCTGGACAGGGAAGCCCCTCTATGAACTCAGAGGCTAA
CAGATAAATAATTGCTGAGCTCAATATAAATTTTGAACCATCAAGTGCTC
TAGCATCATAAAAATATTCTCGTTTGCAGTATATCAAATAGTTTCTTGAA
AGAGCACACTTTCAAACCTTGTGGATAAAATGAAATCTTGAATCTAATTT
AGATTTAATCTTTTTTTTTTCCTGATCCACATTTGTTGATTTTCTGCCTA
TATAGGATACAAAGCATCAACAGGAATCATCTCTTACATATGGTGGGTTT
GGGAAAGAAAGAGCCCACANNAATTAAACATGGAGAACAGACTGGACAAA
CGACACCGNCAGATTTTCGGGTACGTCAGCTNAAAGATCAGCTCATCAAG
GCAAAAGTCTATCTTCACTTNCAGGCATGAGAAACATGGCAATTTNGGTA
GGGGAGCTCGACTGCGCATAANGGAGGTCACGTGCACTGGTGGATGCACC
AAGATCTGATTTGCAAGGGATGCCATGATAAA
back to top