EY675324

Overview
NameEY675324
Unique NameEY675324
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length1093
Libraries
Library NameType
Sweet orange leaf, infected with CiLVcdna_library
Properties
Property NameValue
Genbank descriptionCS00-C1-401-009-B01-CT.F Sweet orange leaf, infected with CiLV Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY675324 ID=EY675324|Name=EY675324|organism=Citrus sinensis|type=EST|length=1093bp
TAAAATGCAGGATTGAGACCCTCTATTGAGCCCTGCATTAGTTCTTATGA
AATGGTATACTCTGGTGTTTACATGGTAATTGCATCCTTTTATGTGCAAA
CTGTGAGTGTGTGAAGAAAACTACTCTAATGTGACACAGTTTGGCATGTG
TTGCAGCAAAAATGTTTCTATTCAACTTTATTAAGCAGCATATTGCTAAG
GACTTGCATCACAATAATAAATGTGTTGTCTATGAAGTANAAAAAAANAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAACAAAAGGGGGGGCGGCATCAAGAGAAAAACACAAAGTTACAC
CCGGCAGTGGGGGGGGGGGAGAGGAGAGAAAATATTCACACTTATTTAAC
CGGGGGGGGGGCGCCCTTTATCCCTGTTTTGGGGGGGGGGGAAAAATTTT
AATTTTGGCGGGCCGTTTATTATTAATGTAGCGGAAAAAGGAAAAAACAC
CGGGGGGTGGCAAAAAAAAAAATCAGTGAGGCCACCAACTCCCCCTTTTC
CCCAAGGTGTGAAAGAAAAAAAAAAAGAAGAACCGCGAGACCTACCCCTT
TATCAAAACTATTATACCACCACATAAAAGGAGGGAATGGGAGGCAACCC
CATATAGAAAGAAACACAAATACGCCACAGGGGAAGTGGGGGGGATATTC
ACTCTATAGAAATTATCTATAGGTATATTTGACACGCAACCATATATACC
CAGACATCTTCTAAAATAGAAAATAAATAAAATAATATAGAGCTAGGGCT
CGAGAAGAAGGGCATCTACCCCAGCAGCAGACAATCAAACAATGAACGGC
ATACAACTTGTAAATATGATGAATAAGATATATTTAAGGGATATAAGGAT
AAGCAAATGCACCACTACCACCCCCAACGAAGAACATGGGGATATGAGAA
GAAGACATGCTTATATCACGATGTAATAGGTATGTCCCGTAACAAAGAAT
AAAGAAGAAAAGAGAAAACGAATTCACCGCAACCGAACGACCCAGTAGGC
GCTAAACACTAAGTATACTGCAACCGAACCAAGTGTACTTTCC
back to top