EY675322

Overview
NameEY675322
Unique NameEY675322
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length888
Libraries
Library NameType
Sweet orange leaf, infected with CiLVcdna_library
Properties
Property NameValue
Genbank descriptionCS00-C1-401-009-A11-CT.F Sweet orange leaf, infected with CiLV Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY675322 ID=EY675322|Name=EY675322|organism=Citrus sinensis|type=EST|length=888bp
GATCAATATAGTTGTTCCCACTTGAAGTAGTAACCCTCAGAAGTATGGAA
GAAAGCCTTCCCCCTTATTGTAGCTGAGGTGCCCATAAATGTAAGTTTGT
TGTCACTTCATGCTTTATTATCATTAGATTGGAAAACATAGAGTGAAATG
CATATTGCTTTTGACAAAGCAAGGGGAAATTCTTCTACTGTTTTACAAAA
AACAATAGAGTGAAATGCATATTACTTTTGACAAAGCAACGGGACATTTA
CATTTTCTTTTTCTTTTTCTCTTTATTTTTAATTATTTCAAGGGTAAGCT
TCAATTCAACCCCTAGTTAGAATGAAAAACTTCACTTTACCCCAAAATAT
GAAAATCTCAATTTTCCCCACCAAATGTCGTTATTTCTCCATTGGTTTTT
GGGGGTGGGCAAATTTACCCAATGTGATCCACCTGGATCGAAAAAAATTT
TCAGGTTCGGATTAAATTCCAATCCGCTTGGGTTGACCAAAAAAAAAAAA
CAAAATCTAAAAAGTAAAGAATAAAACCTAATTGTAAGACTCACTCCCAC
ACCCCAACATCCATCAAACACACTCCCACAAAAATTCCCAATCGCGTGAA
ACCCCACACAACCAAACTAAATTCCTAAAAAAGCTTCCCACACACCCGTC
TATTTGCTTCCCTAAGACAACGTAGCAAACCAAACCTATCCCAAGGCCCT
GATTGCGCCTAAATTGAGTGAACTGGAACAAGGGTGGACGATTGCTCCAT
AGAAAAACCCCAAACAAAGGTGTACAAGTTGAAGGTTGGACCCCACCTAT
AAAAAAAACGGTGGGAAAGAAATTTAAAAAAATTTTGTAAGATAAAGTGC
TCCTTATCCCAAAAAAAACAAAAAAAAATATATAGGGT
back to top