EY675314

Overview
NameEY675314
Unique NameEY675314
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length689
Libraries
Library NameType
Sweet orange leaf, infected with CiLVcdna_library
Properties
Property NameValue
Genbank descriptionCS00-C1-401-009-A02-CT.F Sweet orange leaf, infected with CiLV Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY675314 ID=EY675314|Name=EY675314|organism=Citrus sinensis|type=EST|length=689bp
CTTCACGCCGCCTTGCTTGAGGCGGTCGATGGCCAGCTTGCGGTCCTTCT
GGTCTTTTTCACCGTGCAGGACGAACGCCTTGTACTCCCTGAAGCCACCA
GGCGACCGTAAATACGGTCGGGCCATGGCCCGGGTGTTGGTGAACACAAA
GGCCTTCCGATAGGTCTCGTTGGGCAGCCACCATTTGAGGATCTGCTCCT
TTGTGCACGTTTGTGGGCCACCGGTGAATAATCTGCCGGAAAGGGGGGTC
CAAGTCAAGGACGCCGAACTTTGTTGAACCTGGAGAGGGTCGGGGGTTGG
TTAGGGACATTTGGTCAACAATTTAAAACAGGGTCGAAAACCCCAGGGGG
GGGCCAAAAACCACTTGGGACTGGCCGGGGTGATAACGAAAGTTTTGGGT
ACCAGGGAGGGGGAATAATTATCGAGAGAAAGCTCCAATGGGGAGAAAGG
GGGGGTGGAGGATTACATGAAGGACATCAGGAATTTGTAAATATTACTAT
GGAGGAGCCGGGGTTGGCCGACGGCTTCATGAATATAGATAAGAATTAAT
AATTGACCCGGAGGGAGGGGAAAAAAAATATGGATAATACATGAGAGAGC
TATATTATAATAAAGAAAAATTGAGGTGCGACTATGACGGAGTTAATTAT
AGGAATGAATAAAATATATTTTAACGTTGGTCGTTATGA
back to top